Prev. |  Human A to Z list >  C >  CENPH > 

RBd51D09 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR380481
Clone Name RBd51D09
Clone info. Plasmid clone of human CENPH cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GATTTAGTGGCGGGAAAAGCGACCTTTTCTGAGCGCGTTTGCCTGTTGAGTGGTAGCCTT
Sequence, submitted(2) n.a.
 
Sequence, refered NM_022909.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CENPH (NCBI Gene 64946)  other clone of CENPH in our bank
Synonyms -
Protein Name centromere protein H
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR380481 RBd51D09 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.12.04

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_181121.pl