Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040M01

Clone ID RBdS040M01
HP ID HP04999
Gene ID 64946
Gene Symbol CENPH
Protein Name centromere protein H
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_022909.3
Length of RefSeq (bp) 1405
Chromosome 5p15.2
Reference DDBJ accession
UniGene Hs.631967
5'-terminal sequence GAGCCTTTCCCCTCAACCAGCAATGGAGGAGCAGCCCCAGATGCAAGACGCCGACGAGCC
2011.08.28