Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANAPC11

Gene ID (NCBI) 51529
Gene Symbol ANAPC11
Protein Name anaphase promoting complex subunit 11
Synonyms APC11|Apc11p
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03358)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082148 IRAL005G04 pOTB7 BC000607 NM_016476 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE013937 W01A034O01 pENTR-TOPO IRAL005G04 BC000607 NM_016476  
HGE013943 W01A034O07 pENTR-TOPO IRAL005G04 BC000607 NM_016476  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166530 ARi16F10 pGCAP10 NM_016476.10  
GGAGTCGGGCCGCGACTGTGGTCGTTTTTATACCTTCCCGCGCGGACGCCGGCGCTGCCA
HKR177626 ARi44B02 pGCAP10 NM_016476.10  
GACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTATACCTTCCC
HKR208143 ARiS020F23 pGCAP10 NM_016476.10  
GGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTATACCTTCCCGCGCGGA
HKR243890 ARiS109M02 pGCAP10 NM_016476.10  
CGGCCGGCCGATGGCGTGCGAGACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTG
HKR249018 ARiS122J02 pGCAP10 NM_016476.10  
GATACCTTCCCGCGCGGACGCCGGCGCTGCCAACGGAAGGGCGGGCTCTGCTGCCATGAA
HKR260312 ARiS150M24 pGCAP10 NM_016476.10  
GGCGTGCGAGACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTA
HKR321332 RBb03F12 pKA1U5 NM_016476.10  
GGCACTGGCGTGCGAGACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCG
HKR332482 RBb31D10 pGCAP1 NM_016476.10  
HKR374859 RBd37C11 pGCAP10 NM_016476.10  
GCTCCCCGCACGCTCCGCCCGATCGGCCAGGGCTGGGGGCGCTGGGGGCGCTACGGGCGC
HKR342526 RBb56F06 pGCAP1 NM_016476.10  
GATACCTTCCCGCGCGGACGCCGGCGCTGCCAACGGTAAGGGCGGGTAGGGCGAGACGGA
HKR346501 RBb66E05 pGCAP1 NM_016476.10  
TCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTATACCTTCCCGCG
HKR385346 RBd63G02 pGCAP10 NM_016476.10  
GGCCGGCGCTGCCAACGGAAGGGCGGGTAGGGCGGCTCTGCTGCCATGAAGGTGAAGATT
HKR388457 RBd71C09 pGCAP10 NM_016476.10  
GGTGCGCACTGGCGTGCGAGACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTG
HKR394428 RBd86B04 pGCAP10 NM_016476.10  
GGTGCGAGACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTATA
HKR395374 RBd88H06 pGCAP10 NM_016476.10  
GGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTATACCTTCCCGCGCGGA
HKR406226 RBdS015J10 pGCAP10 NM_016476.10  
GGCTGCCAACGGAAGGGCGGGTAGGGCGGCTCTGCTGCCATGAAGGTGAAGATTAAGTGC
HKR406358 RBdS015O22 pGCAP10 NM_016476.10  
GGTGCGAGACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTATA
HKR430026 RBdS075B02 pGCAP10 NM_016476.10  
GGGCGTGCGAGACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTT
HKR462782 RBdS156P22 pGCAP10 NM_016476.10  
GGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTTATACCTTCCCGCGCGGACGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl