Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075B02

Clone ID RBdS075B02
HP ID HP03180
Gene ID 51529
Gene Symbol ANAPC11
Protein Name anaphase promoting complex subunit 11
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016476.10
Length of RefSeq (bp) 892
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.534456
5'-terminal sequence GGGCGTGCGAGACTCGGCGGGCGCTGTTGAGGGAGTCGGGCCGCGACTGTGGTCGTTTTT
2011.08.28