Prev. |  Human A to Z list >  A >  ANAPC11 > 

RBd63G02 - NRCD Human cDNA Clone

Catalog Number HKR385346
Clone Name RBd63G02
Clone info. Plasmid clone of human ANAPC11 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGCCGGCGCTGCCAACGGAAGGGCGGGTAGGGCGGCTCTGCTGCCATGAAGGTGAAGATT
Sequence, submitted(3) n.a.
 
Sequence, refered NM_016476.10 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) ANAPC11 (NCBI Gene 51529)  other clone of ANAPC11 in our bank
Synonyms APC11|Apc11p|HSPC214
Protein Name anaphase promoting complex subunit 11
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR385346 RBd63G02 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd63G02 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR385346).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl