Prev. | 

RIKEN DNA Bank Human Resource - CHCHD2

Gene ID NCBI Gene 51142 |  KEGG hsa:51142
Gene Symbol CHCHD2
Protein Name coiled-coil-helix-coiled-coil-helix domain containing 2
Synonyms C7orf17|MNRR1|NS2TP|PARK22
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY066831 IRAK167B07 pBluescriptR BC066331 NM_016139 Full/var
HGY081565 IRAL003P05 pOTB7 BC003079 NM_016139 Full
HGY093264 IRAL033C16 pOTB7 BC015639 NM_016139 Full
HGY103536 IRAL058N24 pOTB7 BC071985 NM_016139 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE088443 M01C021B19 pDONR221 IMS03-C10 BC003079 NM_016139  
HGE088491 M01C021D19 pDONR221 IMS03-C10 BC003079 NM_016139  
HGE088539 M01C021F19 pDONR221 IMS03-C10 BC003079 NM_016139  
HGE088587 M01C021H19 pDONR221 IMS03-C10 BC003079 NM_016139  
HGE088635 M01C021J19 pDONR221 IMS03-C10 BC003079 NM_016139  
HGE088683 M01C021L19 pDONR221 IMS03-C10 BC003079 NM_016139  
HGE088731 M01C021N19 pDONR221 IMS03-C10 BC003079 NM_016139  
HGE088779 M01C021P19 pDONR221 IMS03-C10 BC003079 NM_016139  
HGE088445 M01C021B21 pDONR221 IMS03-C11 BC003079 NM_016139  
HGE088493 M01C021D21 pDONR221 IMS03-C11 BC003079 NM_016139  
HGE088541 M01C021F21 pDONR221 IMS03-C11 BC003079 NM_016139  
HGE088589 M01C021H21 pDONR221 IMS03-C11 BC003079 NM_016139  
HGE088637 M01C021J21 pDONR221 IMS03-C11 BC003079 NM_016139  
HGE088685 M01C021L21 pDONR221 IMS03-C11 BC003079 NM_016139  
HGE088733 M01C021N21 pDONR221 IMS03-C11 BC003079 NM_016139  
HGE088781 M01C021P21 pDONR221 IMS03-C11 BC003079 NM_016139  
HGE099644 M01C049B20 pDONR221 MGC14-D10 BC003079 NM_016139  
HGE099692 M01C049D20 pDONR221 MGC14-D10 BC003079 NM_016139  
HGE099740 M01C049F20 pDONR221 MGC14-D10 BC003079 NM_016139  
HGE099788 M01C049H20 pDONR221 MGC14-D10 BC003079 NM_016139  
HGE099836 M01C049J20 pDONR221 MGC14-D10 BC003079 NM_016139  
HGE099884 M01C049L20 pDONR221 MGC14-D10 BC003079 NM_016139  
HGE099932 M01C049N20 pDONR221 MGC14-D10 BC003079 NM_016139  
HGE099980 M01C049P20 pDONR221 MGC14-D10 BC003079 NM_016139  
HGE100438 M01C051B14 pDONR221 MGC15-D07 BC015639 NM_016139  
HGE100486 M01C051D14 pDONR221 MGC15-D07 BC015639 NM_016139  
HGE100534 M01C051F14 pDONR221 MGC15-D07 BC015639 NM_016139  
HGE100582 M01C051H14 pDONR221 MGC15-D07 BC015639 NM_016139  
HGE100630 M01C051J14 pDONR221 MGC15-D07 BC015639 NM_016139  
HGE100678 M01C051L14 pDONR221 MGC15-D07 BC015639 NM_016139  
HGE100726 M01C051N14 pDONR221 MGC15-D07 BC015639 NM_016139  
HGE100774 M01C051P14 pDONR221 MGC15-D07 BC015639 NM_016139  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045284 ARe13D12 pKA1U5 NM_016139.2  
GGGAGGCCTAGCCGTCGCTTACCTAGGATGCCGCGTGGAAGCCGAAGCCGCACCTCCCGC
HKR048947 ARe22G03 pKA1U5 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTTCCGGAGGCCTAGCCGTCGCTTAC
HKR050878 ARe27D06 pKA1U5 NM_016139.2  
GGTCCCACGTCCGGAGGCCTAGCCGTCGCTTACCTAGGATGCCGCGTGGAAGCCGAAGCC
HKR057345 ARe43G01 pKA1U5 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGNTCCGGAGGCCTAGCCGTCGCTTAC
HKR066571 ARe66H03 pKA1U5 NM_016139.2  
GTCTTCGGTGGTTGTCCCACGATCCGGAGGCCTAGCCGTCGCTTACCTAGGATGCCGCGT
HKR077345 ARe93G01 pKA1U5 NM_016139.2  
GCTAGCCGTCGCTTACCTAGGATGCCGCGTGGAAGCCGAAGCCGCACCTCCCGCATGGCC
HKR078552 ARe96G08 pKA1U5 NM_016139.2  
GGGTGGTTGTCCCACGNTCCGGAGGCCTAGCCGTCGCTTACCTAGGATGCCGCGTGGAAG
HKR168902 ARi22E06 pGCAP10 NM_016139.2  
GATCTTCCGGTCTCCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGC
HKR169297 ARi23E01 pGCAP10 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCTTACC
HKR172426 ARi31B02 pGCAP10 NM_016139.2  
GGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCTTACCTAGGATGCCGCGTGGAAGCCGA
HKR172452 ARi31C04 pGCAP10 NM_016139.2  
GCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCTT
HKR181352 ARi53G08 pGCAP10 NM_016139.2  
GATCTTCCGGTCTCCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGC
HKR185377 ARi63H09 pGCAP10 NM_016139.2  
GCTCCCATCTTCCGGTCTCCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCG
HKR186569 ARi66H01 pGCAP10 NM_016139.2  
CAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCTTACC
HKR205224 ARiS013A24 pGCAP10 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCTTACC
HKR219744 ARiS049F24 pGCAP10 NM_016139.2  
GGCTTANCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCTTACCTAGGATG
HKR248990 ARiS122H22 pGCAP10 NM_016139.2  
GGGTCTCCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCCCACGTCCGGAGGCCTAGCCG
HKR276595 ARiS191I03 pGCAP10 NM_016139.2  
GGGTGGTTGTCCCACGTCCGGAGGCCTAGCCGTCGCTTACCTAGGATGCCGCGTGGAAGC
HKR325608 RBb14A08 pKA1U5 NM_016139.2  
ATCCTGAGAAGTCGCTTAGCTCTTCGGGTGGTTGTCACACGNTCCGGAGGCCTAGCCGTC
HKR326546 RBb16G02 pKA1U5 NM_016139.2  
GTCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACCTAGGATGCCGCG
HKR328177 RBb20H09 pKA1U5 NM_016139.2  
GGTCACACGTCCGGAGGCCTAGCCGTCGCGTACCTAGGATGCCGCGTGGAAGCCGAAGCC
HKR335681 RBb39D09 pGCAP1 NM_016139.2  
GCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACATCCGGAGGCCTAGCCGTCGCGT
HKR338949 RBb47G05 pGCAP1 NM_016139.2  
GTCCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGC
HKR344502 RBb61E06 pGCAP1 NM_016139.2  
GGTCACACGTCCGGAGGCCTAGCCGTCGCGTACCTAGGATGCCGCGTGGAAGCCGAAGCC
HKR361326 RBd03F06 pGCAP10 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACC
HKR370549 RBd26G05 pGCAP10 NM_016139.2  
GATCTTCCGGTCTCCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGC
HKR373682 RBd34D10 pGCAP10 NM_016139.2  
GGCCTCCCATCTTCCGGTCTCCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTC
HKR374036 RBd35B12 pGCAP10 NM_016139.2  
GCGCGTACCTAGGATGCCGCGTGGAAGCCGAACCCGCACCTCCCGCATGGCCCCTCCGGC
HKR374500 RBd36E04 pGCAP10 NM_016139.2  
GGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACCTAGGATGCCGCGTGGAAGC
HKR376054 RBd40C06 pGCAP10 NM_016139.2  
GGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACCTAGGATGCCGCGTGGAAGCCGA
HKR382103 RBd55E07 pGCAP10 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGANGCNTNGCCGTCGCGTACC
HKR382950 RBd57G06 pGCAP10 NM_016139.2  
GTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGANGCCTAGCCGTCGCGTA
HKR383353 RBd58G09 pGCAP10 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACC
HKR390552 RBd76G08 pGCAP10 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACC
HKR391349 RBd78G05 pGCAP10 NM_016139.2  
GAGAAGTNNNTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACC
HKR393280 RBd83D08 pGCAP10 NM_016139.2  
GGAGGCCAGCCCCGCCTCCCATCTTCCGGTCTCCTCAGAAGTCGCTTAGCTCTTCGGTGG
HKR399306 RBd98E10 pGCAP10 NM_016139.2  
GAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACCTAGGATGCCGC
HKR405950 RBdS014O14 pGCAP10 NM_016139.2  
GCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGT
HKR406336 RBdS015N24 pGCAP10 NM_016139.2  
GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACC
HKR416326 RBdS040N14 pGCAP10 NM_016139.2  
GAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACCTAGGATGCCGC
HKR428297 RBdS070M09 pGCAP10 NM_016139.2  
GAGCCTAGCCGTCGCGTACCTAGGATGCCGCGTGGAAGCCGAAGCCGCACCTCCCGCATG
HKR433388 RBdS083H20 pGCAP10 NM_016139.2  
GGCCTCCCATCTTCCGGTCTCCTCAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl