Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS015N24

Clone ID RBdS015N24
HP ID HP10018
Gene ID 51142
Gene Symbol CHCHD2
Protein Name coiled-coil-helix-coiled-coil-helix domain containing 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016139.2
Length of RefSeq (bp) 831
Chromosome 7p11.2
Reference DDBJ accession
UniGene Hs.389996
5'-terminal sequence GAGAAGTCGCTTAGCTCTTCGGTGGTTGTCACACGTCCGGAGGCCTAGCCGTCGCGTACC
2011.08.28