Prev. |  Human A to Z list >  C >  CHCHD2 > 

ARe96G08 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR078552
Clone Name ARe96G08
Clone info. Plasmid clone of human CHCHD2 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGGTGGTTGTCCCACGNTCCGGAGGCCTAGCCGTCGCTTACCTAGGATGCCGCGTGGAAG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_016139.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CHCHD2 (NCBI Gene 51142)  other clone of CHCHD2 in our bank
Synonyms C7orf17|MNRR1|NS2TP|PARK22
Protein Name coiled-coil-helix-coiled-coil-helix domain containing 2
KEGG hsa:51142
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR078552 ARe96G08 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.11.19

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl