Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AIPL1

Gene ID (NCBI) 23746
Gene Symbol AIPL1
Protein Name aryl hydrocarbon receptor interacting protein-like 1
Synonyms AIPL2|LCA4
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY091838 IRAL029J22 pOTB7 BC012055 NM_014336 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE006603 W01A016I11 pENTR-TOPO IRAL029J22 BC012055 NM_014336
HGE006605 W01A016I13 pENTR-TOPO IRAL029J22 BC012055 NM_014336
HGE006607 W01A016I15 pENTR-TOPO IRAL029J22 BC012055 NM_014336

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR321750 RBb04G06 pKA1U5 NM_014336.3
GCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAA
HKR321771 RBb04H03 pKA1U5 NM_014336.3
TGCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAA
HKR327728 RBb19F08 pKA1U5 NM_014336.3
GGTGCTGGACACCTCCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGA
HKR370875 RBd27D03 pGCAP10 NM_014336.3
GCTGTGCTGGACACCTCCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTG
HKR373232 RBd33B08 pGCAP10 NM_014336.3
GCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAAC
HKR375629 RBd39B05 pGCAP10 NM_014336.3
GGCTGGACACCTCCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAG
HKR377300 RBd43E04 pGCAP10 NM_014336.3
GTCCTCCGCCTGTGCTGGACACCTCCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCC
HKR379729 RBd49F09 pGCAP10 NM_014336.3
GCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAA
HKR340078 RBb50D06 pGCAP1 NM_014336.3
TGGGGTGCTGGACACCATCCCTTTTCTCCTGCAGCCATGGATGCCGCTTCTGCTCCTGAA
HKR380035 RBd50B11 pGCAP10 NM_014336.3
GCCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAA
HKR382002 RBd55A02 pGCAP10 NM_014336.3
GCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAA
HKR384828 RBd62B04 pGCAP10 NM_014336.3
GGTCTTCCCCGGAGGTGAGATTATCTCCGCCTGTGCTGGACACCTCCCTTTCTCCTGCAG
HKR391354 RBd78G10 pGCAP10 NM_014336.3
GAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAACCATTCTGCACG
HKR391627 RBd79B03 pGCAP10 NM_014336.3
GGTCTTCCCCGGAGGTGAGATTATCTCCGCCTGTGCTGGACACCTCCCTTTCTCCTGCAG
HKR394107 RBd85E11 pGCAP10 NM_014336.3
GCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAA
HKR433532 RBdS083N20 pGCAP10 NM_014336.3
GGCTGGACACCTCCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAG
HKR442049 RBdS105C01 pGCAP10 NM_014336.3
GCTTTTTTTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAA
HKR442206 RBdS105I14 pGCAP10 NM_014336.3
GTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAACCATTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.06

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl