Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083N20

Clone ID RBdS083N20
HP ID HP05221
Gene ID 23746
Gene Symbol AIPL1
Protein Name aryl hydrocarbon receptor interacting protein-like 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014336.3
Length of RefSeq (bp) 2981
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.279887
5'-terminal sequence GGCTGGACACCTCCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAG
2011.08.28