Prev. |  Human A to Z list >  A >  AIPL1 > 

RBb04H03 - NRCD Human cDNA Clone

Catalog Number HKR321771
Clone Name RBb04H03
Clone info. Plasmid clone of human AIPL1 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) TGCCTTTCTCCTGCAGCCATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAA
Sequence, submitted(3) AB593043 [link]
Note Full cds when compared using AB593043
 
Sequence, refered NM_014336.5 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) AIPL1 (NCBI Gene 23746)  other clone of AIPL1 in our bank
Synonyms AIPL2|LCA4
Protein Name aryl hydrocarbon receptor interacting protein like 1
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR321771 RBb04H03 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBb04H03 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR321771).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl