Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARPC5

Gene ID (NCBI) 10092
Gene Symbol ARPC5
Protein Name actin related protein 2/3 complex, subunit 5, 16kDa
Synonyms ARC16|dJ127C7.3|p16-Arc
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY099204 IRAL048A04 pDNR-LIB BC057237 NM_005717 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162008 ARi05A08 pGCAP10 NM_005717.2  
GAAGTGAATCAGGCGCCGGGTAGTGGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGC
HKR048546 ARe21G02 pKA1U5 NM_005717.2  
GGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTGG
HKR169607 ARi24A07 pGCAP10 NM_005717.2  
GGGATAGAGGTGNAANGTGAATCAGGCGCCGGGTAGTGGGTTGCTGNNGCTGGGCTTGCT
HKR059277 ARe48D05 pKA1U5 NM_005717.2  
GCCTTCCCTCGCGCGCGCTCTCCGTGGAAGAGCAGGGGCAGCGTGGGAGGCGCCAAGGGA
HKR203368 ARiS008G24 pGCAP10 NM_005717.2  
GGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTG
HKR203529 ARiS008N17 pGCAP10 NM_005717.2  
GTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTGGTCGGGATTGGGATGT
HKR209426 ARiS023J10 pGCAP10 NM_005717.2  
GGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTGGTCGGGATTGGG
HKR219601 ARiS049A01 pGCAP10 NM_005717.2  
TTTTTTGGCCTTTGCCGCTGGTCGGGATTGGGATGTCGAAGAACACAGTGTCGTCGGCCC
HKR238415 ARiS096A15 pGCAP10 NM_005717.2  
AGAACGGTCCGAGCCGCGGCAGTCGGCGACGCCTCAGAGCGGAAGAGGGAAGTGAATC
HKR238724 ARiS096N12 pGCAP10 NM_005717.2  
GAGTGAATCAGGCGCCGGGTAGTGGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGCG
HKR243846 ARiS109K06 pGCAP10 NM_005717.2  
GGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTGGTCGGGATTGGG
HKR247478 ARiS118L14 pGCAP10 NM_005717.2  
GGGGAAGTGAATCAGGCGCCGGGTAGTGGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGC
HKR327225 RBb18B01 pKA1U5 NM_005717.2  
GGCTGTGTCCTGCGCGCTCCTTCCCTCGCGCGCGCTCTCCGTGGAAGAGCAGGGGCAGCG
HKR430116 RBdS075E20 pGCAP10 NM_005717.2  
GAGTCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAATCAGGCGCCGGGTAGTGGGTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl