Prev. |  KEGG KO K05754 > 

RIKEN DNA Bank Human Resource - ARPC5

Gene ID NCBI Gene 10092 |  KEGG hsa:10092
Gene Symbol ARPC5
Protein Name actin related protein 2/3 complex subunit 5
Synonyms ARC16|dJ127C7.3|p16-Arc
Ortholog resources KEGG ortholog (KEGG orthology K05754) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY099204 IRAL048A04 pDNR-LIB BC057237 NM_005717 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048546 ARe21G02 pKA1U5 NM_005717.2  
GGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTGG
HKR059277 ARe48D05 pKA1U5 NM_005717.2  
GCCTTCCCTCGCGCGCGCTCTCCGTGGAAGAGCAGGGGCAGCGTGGGAGGCGCCAAGGGA
HKR162008 ARi05A08 pGCAP10 NM_005717.2  
GAAGTGAATCAGGCGCCGGGTAGTGGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGC
HKR169607 ARi24A07 pGCAP10 NM_005717.2  
GGGATAGAGGTGNAANGTGAATCAGGCGCCGGGTAGTGGGTTGCTGNNGCTGGGCTTGCT
HKR203368 ARiS008G24 pGCAP10 NM_005717.2  
GGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTG
HKR203529 ARiS008N17 pGCAP10 NM_005717.2  
GTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTGGTCGGGATTGGGATGT
HKR209426 ARiS023J10 pGCAP10 NM_005717.2  
GGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTGGTCGGGATTGGG
HKR219601 ARiS049A01 pGCAP10 NM_005717.2  
TTTTTTGGCCTTTGCCGCTGGTCGGGATTGGGATGTCGAAGAACACAGTGTCGTCGGCCC
HKR238415 ARiS096A15 pGCAP10 NM_005717.2  
AGAACGGTCCGAGCCGCGGCAGTCGGCGACGCCTCAGAGCGGAAGAGGGAAGTGAATC
HKR238724 ARiS096N12 pGCAP10 NM_005717.2  
GAGTGAATCAGGCGCCGGGTAGTGGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGCG
HKR243846 ARiS109K06 pGCAP10 NM_005717.2  
GGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCTGGTCGGGATTGGG
HKR247478 ARiS118L14 pGCAP10 NM_005717.2  
GGGGAAGTGAATCAGGCGCCGGGTAGTGGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGC
HKR327225 RBb18B01 pKA1U5 NM_005717.2  
GGCTGTGTCCTGCGCGCTCCTTCCCTCGCGCGCGCTCTCCGTGGAAGAGCAGGGGCAGCG
HKR430116 RBdS075E20 pGCAP10 NM_005717.2  
GAGTCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAATCAGGCGCCGGGTAGTGGGTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl