Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASH2L

Gene ID (NCBI) 9070
Gene Symbol ASH2L
Protein Name ash2 (absent, small, or homeotic)-like (Drosophila)
Synonyms ASH2|ASH2L1|ASH2L2|Bre2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K14964)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006344 IRAK015O08 pCMV-SPORT6 BC015936 NM_004674 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052152 ARe30G08 pKA1U5 NM_004674.3  
GAGGGGTGGCCGTGATGGCGGCGGCAGGAGCAGGACCTGGCCAGGAAGCGGGTGCCGGGC
HKR222155 ARiS055G11 pGCAP10 NM_004674.3  
GGAGAAGTCCAGGGGTGGCCGTGATGGCGGCGGCAGGAGCAGGACCTGGCCAGGAAGCGG
HKR344411 RBb61A11 pGCAP1 NM_004674.3  
TGGATTCTCGCGAGAAGTCCAGGGGTGGCCGTGATGGCGGCGGCAGGAGCAGGACCTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl