Prev. |  KEGG KO K14964 > 

RIKEN DNA Bank Human Resource - ASH2L

Gene ID NCBI Gene 9070 |  KEGG hsa:9070
Gene Symbol ASH2L
Protein Name ASH2 like histone lysine methyltransferase complex subunit
Synonyms ASH2|ASH2L1|ASH2L2|Bre2
Ortholog resources KEGG ortholog (KEGG orthology K14964) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006344 IRAK015O08 pCMV-SPORT6 BC015936 NM_004674 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052152 ARe30G08 pKA1U5 NM_004674.3  
GAGGGGTGGCCGTGATGGCGGCGGCAGGAGCAGGACCTGGCCAGGAAGCGGGTGCCGGGC
HKR222155 ARiS055G11 pGCAP10 NM_004674.3  
GGAGAAGTCCAGGGGTGGCCGTGATGGCGGCGGCAGGAGCAGGACCTGGCCAGGAAGCGG
HKR344411 RBb61A11 pGCAP1 NM_004674.3 done
TGGATTCTCGCGAGAAGTCCAGGGGTGGCCGTGATGGCGGCGGCAGGAGCAGGACCTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.11.29

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl