Prev. |  Human A to Z list >  A >  ASH2L > 

RBb61A11 - NRCD Human cDNA Clone

Catalog Number HKR344411
Clone Name RBb61A11
Clone info. Plasmid clone of human ASH2L cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) TGGATTCTCGCGAGAAGTCCAGGGGTGGCCGTGATGGCGGCGGCAGGAGCAGGACCTGGC
Sequence, submitted(2) n.a.
 
Sequence, refered NM_004674.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ASH2L (NCBI Gene 9070)  other clone of ASH2L in our bank
Synonyms ASH2|ASH2L1|ASH2L2|Bre2
Protein Name ASH2 like histone lysine methyltransferase complex subunit
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR344411 RBb61A11 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBb61A11a.seq   RBb61A11c.seq   RBb61A11.pdf

References and tips

Featured content

Reference


2019.11.29

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_190131.pl