Prev. |  Human A to Z list >  A >  ASH2L > 

ARiS055G11 - NRCD Human cDNA Clone

Catalog Number HKR222155
Clone Name ARiS055G11
Clone info. Plasmid clone of human ASH2L cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGAGAAGTCCAGGGGTGGCCGTGATGGCGGCGGCAGGAGCAGGACCTGGCCAGGAAGCGG
Sequence, submitted(3) n.a.
Note match to NM_004674.5(1-2541) CDS:full/var (c.1254 A>G)
 
Sequence, refered NM_004674.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) ASH2L (NCBI Gene 9070)  other clone of ASH2L in our bank
Synonyms ASH2|ASH2L1|ASH2L2|Bre2
Protein Name ASH2 like, histone lysine methyltransferase complex subunit
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR222155 ARiS055G11 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARiS055G11 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR222155).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
ARiS055G11a.seq   ARiS055G11c.seq ARiS055G11z.seq ARiS055G11.pdf

References and tips

Featured content

Reference


2023.07.07

NRCDhumcloneList_AR_2023May03.csv - GNP_filter3_NRCD_html_230707.pl