Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - STAM

Gene ID (NCBI) 8027
Gene Symbol STAM
Protein Name signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Synonyms STAM-1|STAM1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)
Featured content Jak-STAT signaling pathwa (human)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01792 pBluescript-STAM-1 Human signal-transducing adaptor molecule (STAM) cDNA
RDB02324 pAxCAhSTAM-1 (forward) Shuttle vector to produce rAd expressing human STAM-1
RDB02325 pAxCAhSTAM-1 (reverse) Shuttle vector to produce rAd expressing human STAM-1
RDB02752 AxCAhSTAM-1 (forward) Recombinant adenovirus harboring human signal-transducing adaptor molecule (STAM) cDNA

RDB_hum_161122.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY013212 IRAK033A12 pBluescriptR BC030586 NM_003473 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059705 ARe49E09 pKA1U5 NM_003473.2  
GAGAGTCGGTCTCTGTTGCTCTTTTTGCCTGAGGAGTCTTCCATCCTACGTCGAGCTCTG
HKR428117 RBdS070E21 pGCAP10 NM_003473.2  
GTCTTCCATCCTACGTCGAGCTCTGACTCCCGTGCTGTCGAGAGGGAGTCCCCGGGGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.24

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl