Prev. |  Human A to Z list >  S >  STAM > 

ARe49E09 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR059705
Clone Name ARe49E09
Clone info. Plasmid clone of human STAM cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GAGAGTCGGTCTCTGTTGCTCTTTTTGCCTGAGGAGTCTTCCATCCTACGTCGAGCTCTG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_003473.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) STAM (NCBI Gene 8027)  other clone of STAM in our bank
Synonyms STAM-1|STAM1
Protein Name signal transducing adaptor molecule
KEGG hsa:8027
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR059705 ARe49E09 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.11.19

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl