Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070E21

Clone ID RBdS070E21
HP ID HP05487
Gene ID 8027
Gene Symbol STAM
Protein Name signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003473.2
Length of RefSeq (bp) 2967
Chromosome 10p14-p13
Reference DDBJ accession
UniGene Hs.441498
5'-terminal sequence GTCTTCCATCCTACGTCGAGCTCTGACTCCCGTGCTGTCGAGAGGGAGTCCCCGGGGACA
2011.08.28