Prev. |  KEGG KO K20813 > 

RIKEN DNA Bank Human Resource - TDG

Gene ID NCBI Gene 6996 |  KEGG hsa:6996
Gene Symbol TDG
Protein Name thymine DNA glycosylase
Synonyms hTDG
Featured content DNA repair (human)
Ortholog resource in our bank

  TDG

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025756 IRAK064G12 pCMV-SPORT6 BC037557 NM_003211 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178882 ARi47D10 pGCAP10 NM_003211.4  
GGTTGGGGTTGTCTTACCGCAGTGAGTACCACGCGGTACTACAGAGACCGGCTGCCCGTG
HKR205378 ARiS013H10 pGCAP10 NM_003211.4  
GCCAGGTCTCTGGGGTTGTCTTACCGCAGTGAGTACCACGCGGTACTACAGAGACCGGCT
HKR370974 RBd27H06 pGCAP10 NM_003211.4  
GGAGTCCAGCCACTGTCTGGGTACTGCCAGCCATCGGGCCCAGGTCTCTGGGGTTGTCTT
HKR474864 RBdS187C16 pGCAP10 NM_003211.4  
GGGAGGAGCTTGAGTCCAGCCACTGTCTGGGTACTGCCAGCCATCGGGCCCAGGTCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl