Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187C16

Clone ID RBdS187C16
HP ID HP07314
Gene ID 6996
Gene Symbol TDG
Protein Name thymine-DNA glycosylase?
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003211.4
Length of RefSeq (bp) 3251
Chromosome 12q24.1
Reference DDBJ accession
UniGene Hs.584809
5'-terminal sequence GGGAGGAGCTTGAGTCCAGCCACTGTCTGGGTACTGCCAGCCATCGGGCCCAGGTCTCTG
2011.08.28