Prev. |  KEGG KO K02896 > 

RIKEN DNA Bank Human Resource - RPL24

Gene ID NCBI Gene 6152 |  KEGG hsa:6152
Gene Symbol RPL24
Protein Name ribosomal protein L24
Synonyms HEL-S-310|L24
Ortholog resources KEGG ortholog (KEGG orthology K02896) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082282 IRAL005L18 pOTB7 BC000690 NM_000986 Full
HGY103132 IRAL057N20 pDNR-LIB BC070193 NM_000986 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042478 ARe06D06 pKA1U5 NM_000986.3  
GCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTG
HKR051206 ARe28A06 pKA1U5 NM_000986.3  
GATCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAG
HKR051376 ARe28H08 pKA1U5 NM_000986.3  
ATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGT
HKR052412 ARe31A12 pKA1U5 NM_000986.3  
GCTCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTG
HKR058002 ARe45A02 pKA1U5 NM_000986.3  
GTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGAT
HKR063374 ARe58H06 pKA1U5 NM_000986.3  
TCTCTCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGC
HKR068473 ARe71D01 pKA1U5 NM_000986.3  
GCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTG
HKR081274 ARf03D02 pKA1U5 NM_000986.3  
ATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGT
HKR169226 ARi23B02 pGCAP10 NM_000986.3  
CGGCCGGCCGATGCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTC
HKR171356 ARi28G12 pGCAP10 NM_000986.3  
TGTTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGT
HKR174810 ARi37A10 pGCAP10 NM_000986.3  
GCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGT
HKR176906 ARi42E10 pGCAP10 NM_000986.3  
GTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAG
HKR180503 ARi51E07 pGCAP10 NM_000986.3  
TAAGTTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCT
HKR181355 ARi53G11 pGCAP10 NM_000986.3  
GCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGT
HKR182105 ARi55E09 pGCAP10 NM_000986.3  
GCTTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGAT
HKR183376 ARi58H08 pGCAP10 NM_000986.3  
CGGCCGGCCGATGTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAG
HKR218303 ARiS045M15 pGCAP10 NM_000986.3  
GCTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGC
HKR219749 ARiS049G05 pGCAP10 NM_000986.3  
GTTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTG
HKR264641 ARiS161K01 pGCAP10 NM_000986.3  
GCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTG
HKR276759 ARiS191O23 pGCAP10 NM_000986.3  
GCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGT
HKR326107 RBb15E11 pKA1U5 NM_000986.3  
GCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGATCTACC
HKR328080 RBb20D08 pKA1U5 NM_000986.3  
GATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGG
HKR334031 RBb35B07 pGCAP1 NM_000986.3  
GGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGC
HKR334836 RBb37B12 pGCAP1 NM_000986.3  
GCTTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGT
HKR338576 RBb46H08 pGCAP1 NM_000986.3  
TTGGAGATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTA
HKR345679 RBb64D07 pGCAP1 NM_000986.3  
GGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGATCTACCCC
HKR347745 RBb69G01 pGCAP1 NM_000986.3  
CTTTTTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAG
HKR364011 RBd10A11 pGCAP10 NM_000986.3  
GCTTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGAT
HKR364012 RBd10A12 pGCAP10 NM_000986.3  
GGGAGCGAACATGGACCCGGCTGCGCGGGTGGTGCGGGCGCTGTGGCCTGGTGGGTGCGC
HKR364108 RBd10E12 pGCAP10 NM_000986.3  
GTTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTG
HKR368928 RBd22F08 pGCAP10 NM_000986.3  
GCTTTTTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTG
HKR369656 RBd24C08 pGCAP10 NM_000986.3  
GGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGA
HKR371628 RBd29B04 pGCAP10 NM_000986.3  
GATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGG
HKR375250 RBd38C02 pGCAP10 NM_000986.3  
GCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGT
HKR389282 RBd73D10 pGCAP10 NM_000986.3  
GCTTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGT
HKR393354 RBd83G10 pGCAP10 NM_000986.3  
GATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGG
HKR394152 RBd85G08 pGCAP10 NM_000986.3  
GCTTTTCNCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGT
HKR405330 RBdS013F10 pGCAP10 NM_000986.3  
GCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGATC
HKR405974 RBdS014P14 pGCAP10 NM_000986.3  
GCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGATC
HKR406201 RBdS015I09 pGCAP10 NM_000986.3  
GCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGT
HKR406370 RBdS015P10 pGCAP10 NM_000986.3  
GTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGC
HKR430354 RBdS075O18 pGCAP10 NM_000986.3  
TGCTCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCT
HKR433201 RBdS083A01 pGCAP10 NM_000986.3  
GGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGATCTACCCC
HKR433425 RBdS083J09 pGCAP10 NM_000986.3  
TGGCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCA
HKR442304 RBdS105M16 pGCAP10 NM_000986.3  
GTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGC
HKR444198 RBdS110I06 pGCAP10 NM_000986.3  
GCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGATCTACC
HKR453097 RBdS132M09 pGCAP10 NM_000986.3  
GCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGT
HKR462653 RBdS156K13 pGCAP10 NM_000986.3  
GCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTG
HKR470867 RBdS177C19 pGCAP10 NM_000986.3  
GATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGG
HKR475068 RBdS187L04 pGCAP10 NM_000986.3  
GTTCTTTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl