Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075O18

Clone ID RBdS075O18
HP ID HP00302
Gene ID 6152
Gene Symbol RPL24
Protein Name ribosomal protein L24
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000986.3
Length of RefSeq (bp) 579
Chromosome 3q12
Reference DDBJ accession
UniGene Hs.477028
5'-terminal sequence TGCTCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCT
2011.08.28