Prev. |  Human A to Z list >  R >  RPL24 > 

RBdS156K13 - NRCD Human cDNA Clone

Catalog Number HKR462653
Clone Name RBdS156K13
Clone info. Plasmid clone of human RPL24 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GCTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTG
Sequence, submitted(3) n.a.
 
Sequence, refered NM_000986.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) RPL24 (NCBI Gene 6152)  other clone of RPL24 in our bank
Synonyms HEL-S-310|L24
Protein Name ribosomal protein L24
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR462653 RBdS156K13 DNA solution JPY 9,460 plus cost of shipping containers, dry ice (if required) and shipping charge

How to cite this biological resource

Materials & Methods section:

The RBdS156K13 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR462653).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.02

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl