Prev. |  KEGG KO K03009 > 

RIKEN DNA Bank Human Resource - POLR2K

Gene ID NCBI Gene 5440 |  KEGG hsa:5440
Gene Symbol POLR2K
Protein Name RNA polymerase II subunit K
Synonyms ABC10-alpha|RPABC4|RPB10alpha|RPB12|RPB7.0|hRPB7.0|hsRPB10a
Ortholog resources KEGG ortholog (KEGG orthology K03009) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001613 IRAK004A13 pCMV-SPORT6 BC000806 NM_005034 Full
HGX008500 IRAK021E04 pCMV-SPORT6 BC018157 NM_005034 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000413 W01A001A13 pENTR-TOPO IRAK021E04 BC018157 NM_005034  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235066 ARiS087L02 pGCAP10 NM_005034.3  
GGGACTAGCCGGGTTGTATTTGGAAACGCGGAGTGAGTTTTTCCGTGCTGTGTAGGGGCT
HKR325321 RBb13F01 pKA1U5 NM_005034.3  
TGGACTAGCCGGGTTGTATTTGGAAACGCGGAGTGAGTTTTTCCGTGCTGTGTAGGGGCT
HKR394128 RBd85F08 pGCAP10 NM_005034.3  
GGGAAGTTGGTCTCGACACCTGGACTAGCCGGGTTGTATTTGGAAACGCGGAGTGAGTTT
HKR428301 RBdS070M13 pGCAP10 NM_005034.3  
GGGAAGTTGGTCTCGACACCTGGACTAGCCGGGTTGTATTTGGAAACGCGGAGTGAGTTT
HKR433473 RBdS083L09 pGCAP10 NM_005034.3  
GGTTGGTCTCGACACCTGGACTAGCCGGGTTGTATTTGGAAACGCGGAGTGAGTTTTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl