Prev. |  Human A to Z list >  P >  POLR2K > 

RBb13F01 - NRCD Human cDNA Clone

Catalog Number HKR325321
Clone Name RBb13F01
Clone info. Plasmid clone of human POLR2K cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) TGGACTAGCCGGGTTGTATTTGGAAACGCGGAGTGAGTTTTTCCGTGCTGTGTAGGGGCT
Sequence, submitted(3) n.a.
 
Sequence, refered NM_005034.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) POLR2K (NCBI Gene 5440)  other clone of POLR2K in our bank
Synonyms ABC10-alpha|RPABC4|RPB10alpha|RPB12|RPB7.0|hRPB7.0|hsRPB10a
Protein Name RNA polymerase II subunit K
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR325321 RBb13F01 DNA solution JPY 9,460 plus cost of shipping containers, dry ice (if required) and shipping charge

How to cite this biological resource

Materials & Methods section:

The RBb13F01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR325321).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
- - - - - - - - - - - - - - - - - - - -
piggyBac vector
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024) (BRC RESOURCE NEWS)
Sensor & Indicator
Virus gene resource
BAC & YAC
Microbial Genomic DNA
♦ ...and more DNA resources
♦ "Don't forget to follow us on Bluesky!"
BRC Resource News RIKEN BRC

2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl