Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070M13

Clone ID RBdS070M13
HP ID HP01366
Gene ID 5440
Gene Symbol POLR2K
Protein Name polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005034.3
Length of RefSeq (bp) 971
Chromosome 8q22.2
Reference DDBJ accession
UniGene Hs.351475
5'-terminal sequence GGGAAGTTGGTCTCGACACCTGGACTAGCCGGGTTGTATTTGGAAACGCGGAGTGAGTTT
2011.08.28