Prev. |  KEGG KO K09028 > 

RIKEN DNA Bank Human Resource - JUNB

Gene ID NCBI Gene 3726 |  KEGG hsa:3726
Gene Symbol JUNB
Protein Name JunB proto-oncogene, AP-1 transcription factor subunit
Synonyms AP-1
Ortholog resources KEGG ortholog (KEGG orthology K09028) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04063 pAxCALNLhjunB (reverse) Shuttle vector to generate rAd harboring human junB (reverse)
RDB04072 pAxCALNLhjunB (reverse) Shuttle vector to generate rAd harboring human junB (reverse)
RDB03475 pAxCALNLhjunB (forward) Shuttle vector to generate rAd harboring human junB (forward)
RDB03485 pAxCALNLhjunB (forward) Shuttle vector to generate rAd harboring human junB (forward)
RDB03577 pAxCALNLhjunB (forward) Shuttle vector to generate rAd harboring human junB (forward)
RDB05389 pAxCALNLhjunB (forward) Shuttle vector to generate rAd harboring human junB (forward)
RDB05390 pAxCALNLhjunB (reverse) Shuttle vector to generate rAd harboring human junB (reverse)
RDB07502 pCMFlag_hsJUNB Expression vector of human JUNB

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085295 IRAL013D23 pOTB7 BC004250 NM_002229 Full
HGY089571 IRAL023P11 pOTB7 BC009466 NM_002229
HGY089576 IRAL023P16 pOTB7 BC009465 NM_002229 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001521 W01A003N09 pENTR-TOPO IRAL023P11 BC009466 NM_002229  
HGE001523 W01A003N11 pENTR-TOPO IRAL023P11 BC009466 NM_002229  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040921 ARe02F01 pKA1U5 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR059748 ARe49G04 pKA1U5 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR074083 ARe85D11 pKA1U5 NM_002229.2  
GGGCTGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGG
HKR238493 ARiS096D21 pGCAP10 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR322580 RBb06H12 pKA1U5 NM_002229.2  
GTGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGNNAGCAGGGAGCTGGGAGCTGGGGG
HKR383332 RBd58F12 pGCAP10 NM_002229.2  
GGGGACCTTGAGAGCGGNCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR393724 RBd84F04 pGCAP10 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR395227 RBd88B03 pGCAP10 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR406038 RBdS015B14 pGCAP10 NM_002229.2  
GTGNNNNCTTNNGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGG
HKR462510 RBdS156E14 pGCAP10 NM_002229.2  
GTGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl