DNA Bank Top |  KEGG KO K09028 > 

RIKEN DNA Bank Human Resource - JUNB

Gene ID NCBI Gene 3726 |  KEGG hsa:3726
Gene Symbol JUNB
Protein Name JunB proto-oncogene, AP-1 transcription factor subunit
Synonyms AP-1

Link

Ortholog resource in our bank

  JUNB


External database

human JUNB

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07502 pCMFlag_hsJUNB Expression vector of human JUNB.    
RDB05390 pAxCALNLhjunB (reverse) Shuttle vector to generate rAd harboring human junB (reverse)    
RDB05389 pAxCALNLhjunB (forward) Shuttle vector to generate rAd harboring human junB (forward)    
RDB04072 pAxCALNLhjunB (reverse) Shuttle vector to generate rAd harboring human junB (reverse)    
RDB04063 pAxCALNLhjunB (reverse) Shuttle vector to generate rAd harboring human junB (reverse)    
RDB03577 pAxCALNLhjunB (forward) Shuttle vector to generate rAd harboring human junB (forward)    
RDB03485 pAxCALNLhjunB (forward) Shuttle vector to generate rAd harboring human junB (forward)    
RDB03475 pAxCALNLhjunB (forward) Shuttle vector to generate rAd harboring human junB (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089576 IRAL023P16 pOTB7 BC009465 NM_002229 Full/var
HGY085295 IRAL013D23 pOTB7 BC004250 NM_002229 Full
HGY089571 IRAL023P11 pOTB7 BC009466 NM_002229

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001521 W01A003N09 pENTR-TOPO IRAL023P11 BC009466 NM_002229  
HGE001523 W01A003N11 pENTR-TOPO IRAL023P11 BC009466 NM_002229  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040921 ARe02F01 pKA1U5 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR059748 ARe49G04 pKA1U5 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR074083 ARe85D11 pKA1U5 NM_002229.2  
GGGCTGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGG
HKR238493 ARiS096D21 pGCAP10 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR322580 RBb06H12 pKA1U5 NM_002229.2  
GTGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGNNAGCAGGGAGCTGGGAGCTGGGGG
HKR383332 RBd58F12 pGCAP10 NM_002229.2  
GGGGACCTTGAGAGCGGNCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR393724 RBd84F04 pGCAP10 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR395227 RBd88B03 pGCAP10 NM_002229.2  
GGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGGA
HKR406038 RBdS015B14 pGCAP10 NM_002229.2  
GTGNNNNCTTNNGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGG
HKR462510 RBdS156E14 pGCAP10 NM_002229.2  
GTGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl