Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156E14

Clone ID RBdS156E14
HP ID HP01106
Gene ID 3726
Gene Symbol JUNB
Protein Name jun B proto-oncogene
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002229.2
Length of RefSeq (bp) 1832
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.25292
5'-terminal sequence GTGGGACCTTGAGAGCGGCCAGGCCAGCCTCGGAGCCAGCAGGGAGCTGGGAGCTGGGGG
2011.08.28