Prev. |  KEGG KO K13625 > 

RIKEN DNA Bank Human Resource - FTL

Gene ID NCBI Gene 2512 |  KEGG hsa:2512
Gene Symbol FTL
Protein Name ferritin light chain
Synonyms LFTD|NBIA3
Ortholog resources KEGG ortholog (KEGG orthology K13625) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067375 IRAK168H07 pBluescriptR BC067772 NM_000146 Full/var
HGY083718 IRAL009E22 pOTB7 BC002991 NM_000146 Full
HGY085277 IRAL013D05 pOTB7 BC004245 NM_000146 Full
HGY088569 IRAL021H01 pDNR-LIB BC008439 NM_000146 Full
HGY091232 IRAL028B08 pOTB7 BC018990 NM_000146 Full
HGY092474 IRAL031D02 pDNR-LIB BC013928 NM_000146 Full/var
HGY092759 IRAL031O23 pDNR-LIB BC021670 NM_000146 Full/var
HGY092994 IRAL032I02 pDNR-LIB BC016354 NM_000146 Full
HGY093164 IRAL032P04 pDNR-LIB BC016715 NM_000146 Full/var
HGY093174 IRAL032P14 pDNR-LIB BC016346 NM_000146 Full
HGY099211 IRAL048A11 pDNR-LIB BC058820 NM_000146 Full
HGY100654 IRAL051K14 pDNR-LIB BC062708 NM_000146 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE012522 W01A031F02 pENTR-TOPO IRAK168H07 BC067772 NM_000146  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040498 ARe01E02 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR043273 ARe08D01 pKA1U5 NM_000146.3  
TGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGA
HKR044076 ARe10D04 pKA1U5 NM_000146.3  
GGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGA
HKR045203 ARe13A03 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR045352 ARe13G08 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR046812 ARe17A12 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR047626 ARe19B02 pKA1U5 NM_000146.3  
ATCCTGGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGA
HKR048156 ARe20G12 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR049676 ARe24D04 pKA1U5 NM_000146.3  
GGCAGCTTCGGCGGTCCCGCGGGTCTGTCTCTNNCTTNACAGTGTTTGGACGGAACAGAT
HKR050508 ARe26E12 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR050572 ARe26H04 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR050928 ARe27F08 pKA1U5 NM_000146.3  
GCCCCCTCGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGG
HKR051635 ARe29B11 pKA1U5 NM_000146.3  
GGCAGCTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGATGTTTGGACGGAACAG
HKR054007 ARe35A07 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR054156 ARe35G12 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR055369 ARe38H01 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR055605 ARe39A05 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR057774 ARe44H06 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTNAACAGATGTTTGGACGGAACAGA
HKR059745 ARe49G01 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR062975 ARe57H07 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR063658 ARe59C10 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR065327 ARe63F07 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR067700 ARe69E04 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTCCCTTTAAANAGTGTTTGGACGGAACAGA
HKR068855 ARe72C07 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR070025 ARe75B01 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGATGTTTGGACGGAACAGA
HKR071728 ARe79F08 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR072179 ARe80H11 pKA1U5 NM_000146.3  
GNCANTTNAGCNGTCNCGCNGGATNTGTNCTCGTNGCNTNCAANANGTGTTTGGCANGGN
HKR074079 ARe85D07 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGATCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGA
HKR074176 ARe85H08 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR074426 ARe86B02 pKA1U5 NM_000146.3  
ATCCTGGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGA
HKR074905 ARe87E09 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR078103 ARe95E07 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR082170 ARf05H02 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR162151 ARi05G07 pGCAP10 NM_000146.3  
GTCGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAG
HKR163249 ARi08C01 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR163250 ARi08C02 pGCAP10 NM_000146.3  
GAGTCCGGAAGCCGGGGATCCGCGGCCATGACGGTGCCGGTCCGCGGCTTCTCGCTGCTC
HKR166027 ARi15B03 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR166097 ARi15E01 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACNGTGTTTGGACGGAACAGAT
HKR166473 ARi16D01 pGCAP10 NM_000146.3  
GNGGNGTGTTCGNGNGNNNGGAGAGCGTAGCGATATNNATGGGATGAATGAAGTTTNNAA
HKR166498 ARi16E02 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR167201 ARi18A01 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR168006 ARi20A06 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR170103 ARi25E07 pGCAP10 NM_000146.3  
TGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGA
HKR170453 ARi26C05 pGCAP10 NM_000146.3  
GCTCGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACA
HKR170528 ARi26F08 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR172574 ARi31H06 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR173607 ARi34A07 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR174121 ARi35F01 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR175747 ARi39G03 pGCAP10 NM_000146.3  
GGCCCTAGCCACGTCCCCTCGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACA
HKR176108 ARi40E12 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR176145 ARi40G01 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR177283 ARi43D11 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR177349 ARi43G05 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR177605 ARi44A05 pGCAP10 NM_000146.3  
AGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGATCCG
HKR178402 ARi46A02 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR180451 ARi51C03 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR183306 ARi58E10 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR183355 ARi58G11 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR185675 ARi64D03 pGCAP10 NM_000146.3  
HKR186923 ARi67F03 pGCAP10 NM_000146.3  
GGGGGAGGATCACCCCGCCCGCTGAGGGGTCGTGGGATTCAAACCCGTATGCACGGNACC
HKR187702 ARi69E06 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR203445 ARiS008K05 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGNCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR203498 ARiS008M10 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR205383 ARiS013H15 pGCAP10 NM_000146.3  
GTGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAG
HKR205445 ARiS013K05 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR208101 ARiS020E05 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR218052 ARiS045C04 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR218141 ARiS045F21 pGCAP10 NM_000146.3  
CGGCCGGCCGATGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTG
HKR218272 ARiS045L08 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR219871 ARiS049L07 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR219897 ARiS049M09 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR219973 ARiS049P13 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR234175 ARiS085H07 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR234946 ARiS087G02 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR235229 ARiS088B05 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR235288 ARiS088D16 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR235412 ARiS088I20 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR235572 ARiS088P12 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR243675 ARiS109D03 pGCAP10 NM_000146.3  
GGCGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAG
HKR243799 ARiS109I07 pGCAP10 NM_000146.3  
GGCAGTTCNNCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR247302 ARiS118E06 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR249106 ARiS122M18 pGCAP10 NM_000146.3  
CGGCCGGCCGATGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTG
HKR264559 ARiS161G15 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR277849 ARiS194K09 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR322836 RBb07B12 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR323377 RBb08H09 pKA1U5 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR333350 RBb33G06 pGCAP1 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTTGGACGGAACAGA
HKR334146 RBb35G02 pGCAP1 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR335234 RBb38B10 pGCAP1 NM_000146.3  
TGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGA
HKR336449 RBb41C01 pGCAP1 NM_000146.3  
GGCCCTAGCCACGTCCCCTCGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACA
HKR339749 RBb49G05 pGCAP1 NM_000146.3  
TGGCGGNCTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCACCCTTNNAANGGACGGAACA
HKR340897 RBb52E01 pGCAP1 NM_000146.3  
HKR341649 RBb54C01 pGCAP1 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGNTGTTTGGACGGAACAGA
HKR341683 RBb54D11 pGCAP1 NM_000146.3  
GGAGGGCCGGCGCACCATAAAAGAAGCCGCCCTAGCCACGTCCCCTCGCAGTTCGGCGGT
HKR364429 RBd11B05 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR372550 RBd31G06 pGCAP10 NM_000146.3  
TTGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAG
HKR376029 RBd40B05 pGCAP10 NM_000146.3  
TGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGA
HKR376455 RBd41C07 pGCAP10 NM_000146.3  
GGAACTGACTTTCATTCNTCTCATTGTAGCTACGGGATTACAAAAGCATCAAGAATGCTC
HKR379371 RBd48H03 pGCAP10 NM_000146.3  
TGGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGA
HKR382457 RBd56C09 pGCAP10 NM_000146.3  
GCCCCTCGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGA
HKR386153 RBd65G09 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR390946 RBd77G02 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR394456 RBd86C08 pGCAP10 NM_000146.3  
GAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGATCC
HKR398483 RBd96D11 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR402978 RBdS007H10 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR408945 RBdS022G01 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR428054 RBdS070C06 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR430025 RBdS075B01 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR444149 RBdS110G05 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR444164 RBdS110G20 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR453132 RBdS132N20 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR462507 RBdS156E11 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
HKR475098 RBdS187M10 pGCAP10 NM_000146.3  
GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl