Prev. |  Human A to Z list >  F >  FTL > 

RBd77G02 - NRCD Human cDNA Clone

Catalog Number HKR390946
Clone Name RBd77G02
Clone info. Plasmid clone of human FTL cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
Sequence, submitted(3) n.a.
 
Sequence, refered NM_000146.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) FTL (NCBI Gene 2512)  other clone of FTL in our bank
Synonyms LFTD|NBIA3
Protein Name ferritin light chain
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR390946 RBd77G02 DNA solution JPY 9,460 plus cost of shipping containers, dry ice (if required) and shipping charge

How to cite this biological resource

Materials & Methods section:

The RBd77G02 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR390946).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl