Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110G05

Clone ID RBdS110G05
HP ID HP00122
Gene ID 2512
Gene Symbol FTL
Protein Name ferritin, light polypeptide
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000146.3
Length of RefSeq (bp) 889
Chromosome 19q13.3-q13.4
Reference DDBJ accession
UniGene Hs.433670
5'-terminal sequence GGCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGAT
2011.08.28