Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CKS1B

Gene ID (NCBI) 1163
Gene Symbol CKS1B
Protein Name CDC28 protein kinase regulatory subunit 1B
Synonyms CKS1|PNAS-16|PNAS-18|ckshs1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086882 IRAL017D10 pOTB7 BC007751 NM_001826 Full
HGY093202 IRAL033A02 pOTB7 BC015629 NM_001826 Full
HGY102956 IRAL057G12 pDNR-LIB BC070319 NM_001826 Full
HGY103032 IRAL057J16 pDNR-LIB BC070320 NM_001826 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048900 ARe22E04 pKA1U5 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR171707 ARi29E11 pGCAP10 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR052082 ARe30D10 pKA1U5 NM_001826.2  
GGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGC
HKR173776 ARi34H08 pGCAP10 NM_001826.2  
TGGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCG
HKR174060 ARi35C12 pGCAP10 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR060073 ARe50D01 pKA1U5 NM_001826.2  
GCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAG
HKR066401 ARe66A01 pKA1U5 NM_001826.2  
GGCGTGCTGCTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCG
HKR070458 ARe76C10 pKA1U5 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCCGCTCGGGGCTGAAGGCTAGCAAACCGA
HKR074521 ARe86F01 pKA1U5 NM_001826.2  
GGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGCGATCATGTCG
HKR222214 ARiS055I22 pGCAP10 NM_001826.2  
GGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGCGATCATGTCGCA
HKR234878 ARiS087D06 pGCAP10 NM_001826.2  
GGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGC
HKR361255 RBd03C07 pGCAP10 NM_001826.2  
GGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGCGATCATGTCGCACAAACAAA
HKR324580 RBb11H12 pKA1U5 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCNGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR329327 RBb23F07 pGCAP1 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR332122 RBb30F02 pGCAP1 NM_001826.2  
GCCAAAGTGGGTGGGAGCGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCT
HKR388433 RBd71B09 pGCAP10 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR394125 RBd85F05 pGCAP10 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR395778 RBd89H10 pGCAP10 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR408931 RBdS022F11 pGCAP10 NM_001826.2  
GAAAGTGGGTGGGAGCGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGA
HKR409143 RBdS022O07 pGCAP10 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR416203 RBdS040I11 pGCAP10 NM_001826.2  
GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGA
HKR433535 RBdS083N23 pGCAP10 NM_001826.2  
GGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGCGATCATGT
HKR475027 RBdS187J11 pGCAP10 NM_001826.2  
GGTGCTGTTGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl