Prev. |  Human A to Z list >  C >  CKS1B > 

RBb11H12 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR324580
Clone Name RBb11H12
Clone info. Plasmid clone of human CKS1B cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGCGTGCTGTTGGGAGTTGCTTGGAGGTTGGCNGCGCGGGGCTGAAGGCTAGCAAACCGA
Sequence, submitted(2) n.a.
 
Sequence, refered NM_001826.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) CKS1B (NCBI Gene 1163)  other clone of CKS1B in our bank
Synonyms CKS1|PNAS-16|PNAS-18|ckshs1
Protein Name CDC28 protein kinase regulatory subunit 1B
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR324580 RBb11H12 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.12.05

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_181121.pl