Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083N23

Clone ID RBdS083N23
HP ID HP02142
Gene ID 1163
Gene Symbol CKS1B
Protein Name CDC28 protein kinase regulatory subunit 1B
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001826.2
Length of RefSeq (bp) 834
Chromosome 1q21.2
Reference DDBJ accession
UniGene Hs.374378
5'-terminal sequence GGGGAGTTGCTTGGAGGTTGGCGGCGCGGGGCTGAAGGCTAGCAAACCGAGCGATCATGT
2011.08.28