RIKEN DNA Bank Human Resource - CCNB1

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison		Status
			Refered mRNA(1)	CDS status
	5'-terminal sequence(2)
HKR059257	ARe48C09	pKA1U5	NM_031966.2
	TGTCTCGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGGTGTAGGTCCTTGGCTG
HKR080831	ARf02B07	pKA1U5	NM_031966.2
	GACGGCTGTTTGGTTTCTGCTGGGTGTAGGTCCTTGGCTGGTCGGGCCTCCGGTGTTCTG
HKR187380	ARi68H12	pGCAP10	NM_031966.2
	GGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGGTCGG
HKR279210	ARiS198A10	pGCAP10	NM_031966.2
	TGGGCGTGCTTGCGGCGGAACGGCNGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGGTC
HKR321347	RBb03G03	pKA1U5	NM_031966.2
	GGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCCNNTTGTAGGTCCTTGGCTGGTCGGGCC
HKR323346	RBb08G02	pKA1U5	NM_031966.2	Full
	GGTTCTGCTTCTCCCCGCTGAGCTGCTGCCTGGTGAAGAGGAAGCCATGGCGCTCCGAGT
HKR389752	RBd74G08	pGCAP10	NM_031966.2
	GTCTCGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGG
HKR461887	RBdS154L23	pGCAP10	NM_031966.2
	GTCTCGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

2023.05.10