Prev. |  KEGG KO K05868 > 

RIKEN DNA Bank Human Resource - CCNB1

Gene ID NCBI Gene 891 |  KEGG hsa:891
Gene Symbol CCNB1
Protein Name cyclin B1
Synonyms CCNB
Ortholog resource in our bank

  CCNB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080888 IRAL002D16 pOTB7 BC006510 NM_031966 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059257 ARe48C09 pKA1U5 NM_031966.2  
TGTCTCGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGGTGTAGGTCCTTGGCTG
HKR080831 ARf02B07 pKA1U5 NM_031966.2  
GACGGCTGTTTGGTTTCTGCTGGGTGTAGGTCCTTGGCTGGTCGGGCCTCCGGTGTTCTG
HKR187380 ARi68H12 pGCAP10 NM_031966.2  
GGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGGTCGG
HKR279210 ARiS198A10 pGCAP10 NM_031966.2  
TGGGCGTGCTTGCGGCGGAACGGCNGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGGTC
HKR321347 RBb03G03 pKA1U5 NM_031966.2  
GGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCCNNTTGTAGGTCCTTGGCTGGTCGGGCC
HKR323346 RBb08G02 pKA1U5 NM_031966.2 done
GGTTCTGCTTCTCCCCGCTGAGCTGCTGCCTGGTGAAGAGGAAGCCATGGCGCTCCGAGT
HKR389752 RBd74G08 pGCAP10 NM_031966.2  
GTCTCGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGG
HKR461887 RBdS154L23 pGCAP10 NM_031966.2 done
GTCTCGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl