Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - ARiS198A10

Clone ID ARiS198A10
HP ID finder HP00071
Gene ID 891
Gene Symbol finder CCNB1
Protein Name cyclin B1
Vector(1) pGCAP10
Accession No. in DDBJ(2)(link)
RefSeq mRNA NM_031966.2
Reference DDBJ accession
UniGene Hs.23960
KEGG(3) (link) 891
5'-terminal sequence(4) TGGGCGTGCTTGCGGCGGAACGGCNGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGGTC

Results of terminal sequence of the clone

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
PDF File
ARiS198A10a.seq   ARiS198A10c.seq ARiS198A10.pdf

Click finder to find other clones.
(1) Please visit plasmidVector Information for the inforation of vectors and sequence primers.
(2) Accession indicates DNA sequence of the insert.
(3) The Kyoto Encyclopedia of Genes and Genomes of the Kanehisa Laboratories in the Bioinformatics Center of Kyoto University and the Human Genome Center of the University of Tokyo.
(4) 5' terminal sequence of inserted fragment provided from the depositor is indicated.


2013.09.19

NRCDhumcloneList_AR.csv - GNP_filter3_NRCD_html.pl