Clone ID | RBd74G08 |
---|---|
HP ID ![]() |
HP00071 |
Gene ID | 891 |
Gene Symbol ![]() |
CCNB1 |
Protein Name | cyclin B1 |
Vector(1) | pGCAP10 |
Accession No. in DDBJ(2)(link) | |
RefSeq mRNA | NM_031966.2 |
Reference DDBJ accession | |
UniGene | Hs.23960 |
KEGG(3) (link) | 891 |
5'-terminal sequence(4) | GTCTCGGCGTGCTGCGGCGGAACGGCTGTTGGTTTCTGCTGGTTGTAGGTCCTTGGCTGG |
Results of terminal sequence of the clone
Seq File (by primer A) |
Seq File (by primer B) |
Seq File (by primer C) |
PDF File |
---|---|---|---|
RBd74G08a.seq | RBd74G08c.seq | RBd74G08.pdf |
Click to find other clones.
(1) Please visit Vector Information for the inforation of vectors and sequence primers.
(2) Accession indicates DNA sequence of the insert.
(3) The Kyoto Encyclopedia of Genes and Genomes of the Kanehisa Laboratories in the Bioinformatics Center of Kyoto University and the Human Genome Center of the University of Tokyo.
(4) 5' terminal sequence of inserted fragment provided from the depositor is indicated.
2013.09.19
NRCDhumcloneList_RB.csv - GNP_filter3_NRCD_html.pl