Prev. |  KEGG KO K08055 > 

RIKEN DNA Bank Human Resource - B2M

Gene ID NCBI Gene 567 |  KEGG hsa:567
Gene Symbol B2M
Protein Name beta-2-microglobulin
Synonyms IMD43
Ortholog resources KEGG ortholog (KEGG orthology K08055) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01046 pHu-beta 2m Human beta2 microglobin cDNA
RDB01128 pHu-beta 2m (BS) Human beta2 microglobin cDNA
RDB03438 phB2Mi_i_DsRed2 Expression vector of human microglobulin
RDB03439 phB2Mi_i_EGFP Expression vector of human microblobulin
RDB03701 phuB2Mi Plasmid clone of PCR fragment of human beta 2 micro globin cDNA
RDB05472 pKM2L-phB2M Promoter Bank clone, Human beta-2 microglobulin (B2M) promoter
RDB05074 pAxCALNLhB2M(forward) Shuttle vector to generate rAd expressing human B2M
RDB05075 pAxCALNLhB2M(reverse) Shuttle vector to generate rAd expressing human B2M
RDB05176 pAxCALNLhB2M (forward) Shuttle vector to generate rAd harboring human B2M (forward)
RDB05177 pAxCALNLhB2M (reverse) Shuttle vector to generate rAd harboring human B2M (reverse)
RDB07479 pGL4-phB2M Promoter collection, Human B2M promoter

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027762 IRAK069G18 pCMV-SPORT6 BC032589 NM_004048 Full
HGX056115 IRAK140E19 pCMV-SPORT6 BC064910 NM_004048 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028347 W01A070O11 pENTR-TOPO IRAK069G18 BC032589 NM_004048  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052097 ARe30E01 pKA1U5 NM_004048.2 done
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR054455 ARe36C07 pKA1U5 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR054853 ARe37C05 pKA1U5 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR067673 ARe69D01 pKA1U5 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR070106 ARe75E10 pKA1U5 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR078808 ARe97A08 pKA1U5 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR164527 ARi11F07 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR167754 ARi19G10 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR170450 ARi26C02 pGCAP10 NM_004048.2  
CGGCCGGCCGATGGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCG
HKR171771 ARi29H03 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR174073 ARi35D01 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR174555 ARi36G11 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR178180 ARi45H12 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR178877 ARi47D05 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR179725 ARi49F05 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR184032 ARi60B08 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR184049 ARi60C01 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR184432 ARi61B08 pGCAP10 NM_004048.2  
GGGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCT
HKR185211 ARi63A11 pGCAP10 NM_004048.2  
ATTCCTGANCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCTCG
HKR185355 ARi63G11 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR203540 ARiS008O04 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR209247 ARiS023B23 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGANATGTCTCGCTCCGTGGCCTTAGCTG
HKR209248 ARiS023B24 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR219751 ARiS049G07 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR219895 ARiS049M07 pGCAP10 NM_004048.2  
GANACCTTCTTCTCCNAGANTCNTCGGGGTTNCCTGCTTCTCCNNGGCTTGGACTGAACC
HKR219905 ARiS049M17 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR235529 ARiS088N17 pGCAP10 NM_004048.2  
CGGCCGGCCGATGATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGC
HKR238488 ARiS096D16 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR249041 ARiS122K01 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR264427 ARiS161B03 pGCAP10 NM_004048.2  
GATTCCTGAANCTGACANCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR264455 ARiS161C07 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR276740 ARiS191O04 pGCAP10 NM_004048.2  
GATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGCT
HKR322081 RBb05D09 pKA1U5 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR381681 RBd54D09 pGCAP10 NM_004048.2  
GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
HKR408869 RBdS022C21 pGCAP10 NM_004048.2  
GCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAGGCTATCCAGCGTACTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl