Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022C21

Clone ID RBdS022C21
HP ID HP00282
Gene ID 567
Gene Symbol B2M
Protein Name beta-2-microglobulin
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004048.2
Length of RefSeq (bp) 987
Chromosome 15q21-q22.2
Reference DDBJ accession
UniGene Hs.709313
5'-terminal sequence GCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAGGCTATCCAGCGTACTCCA
2011.08.28