Prev. |  Human A to Z list >  B >  B2M > 

ARe30E01 - NRCD Human cDNA Clone

Catalog Number HKR052097
Clone Name ARe30E01
Clone info. Plasmid clone of human B2M cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGGGCATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_004048.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) B2M (NCBI Gene 567)  other clone of B2M in our bank
Synonyms IMD43
Protein Name beta-2-microglobulin
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR052097 ARe30E01 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARe30E01a.seq   ARe30E01c.seq   ARe30E01.pdf

References and tips

Featured content

Reference


2021.08.05

NRCDhumcloneList_AR_210404.csv - GNP_filter3_NRCD_html_190131.pl