Prev. |  KEGG KO K18622 > 

RIKEN DNA Bank Human Resource - ADD2

Gene ID NCBI Gene 119 |  KEGG hsa:119
Gene Symbol ADD2
Protein Name adducin 2
Synonyms ADDB
Ortholog resource in our bank

  ADD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056211 IRAK140I19 pCMV-SPORT6 BC065525 NM_001617 Full/var
HGX032928 IRAK082F08 pCMV-SPORT6 BC041666 NM_017488 Full
HGX044224 IRAK110J08 pCMV-SPORT6 BC051882 NM_017488 Full/var
HGX047888 IRAK119L24 pCMV-SPORT6 BC056881 NM_017488 Full/var
HGY089020 IRAL022J04 pOTB7 BC008709 NM_017483 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096047 M01C040B23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096095 M01C040D23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096143 M01C040F23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096191 M01C040H23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096239 M01C040J23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096287 M01C040L23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096335 M01C040N23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096383 M01C040P23 pDONR221 MGC09-G12 BC065525 NM_001617  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326525 RBb16F05 pKA1U5 NM_017482.4 full cds  
TGACCGCGCAGCGGCCTTTTGTCAGCGCGCAGGGCCAGGAGAGCTCTCATTTCCTCCCAG
HKR444267 RBdS110L03 pGCAP10 NM_001617.2  
GATTTTCCTCCCAGCCTCGTGCGGGAAATGGCTTTAATTCTGACGGCAGGGCTGTGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl