Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ADD2

Gene ID (NCBI) 119
Gene Symbol ADD2
Protein Name adducin 2 (beta)
Synonyms ADDB
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K18622)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056211 IRAK140I19 pCMV-SPORT6 BC065525 NM_001617 Full/var
HGX032928 IRAK082F08 pCMV-SPORT6 BC041666 NM_017488 Full
HGX044224 IRAK110J08 pCMV-SPORT6 BC051882 NM_017488 Full/var
HGX047888 IRAK119L24 pCMV-SPORT6 BC056881 NM_017488 Full/var
HGY089020 IRAL022J04 pOTB7 BC008709 NM_017483 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096047 M01C040B23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096095 M01C040D23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096143 M01C040F23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096191 M01C040H23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096239 M01C040J23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096287 M01C040L23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096335 M01C040N23 pDONR221 MGC09-G12 BC065525 NM_001617  
HGE096383 M01C040P23 pDONR221 MGC09-G12 BC065525 NM_001617  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326525 RBb16F05 pKA1U5 NM_001617.2  
TGACCGCGCAGCGGCCTTTTGTCAGCGCGCAGGGCCAGGAGAGCTCTCATTTCCTCCCAG
HKR444267 RBdS110L03 pGCAP10 NM_001617.2  
GATTTTCCTCCCAGCCTCGTGCGGGAAATGGCTTTAATTCTGACGGCAGGGCTGTGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.07.20

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl