Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110L03

Clone ID RBdS110L03
HP ID HP05506
Gene ID 119
Gene Symbol ADD2
Protein Name adducin 2 (beta)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001617.2
Length of RefSeq (bp) 3957
Chromosome 2p13.3
Reference DDBJ accession
UniGene Hs.188528
5'-terminal sequence GATTTTCCTCCCAGCCTCGTGCGGGAAATGGCTTTAATTCTGACGGCAGGGCTGTGAGGG
2011.08.28