Prev. |  Human A to Z list >  A >  ADD2 > 

NRCD Human cDNA Clone - RBb16F05

Catalog Number HKR326525
Clone Name RBb16F05
Clone info. Plasmid clone of human ADD2 cDNA with SV40 promoter
Vector plasmidClick for information pKA1U5
5'-terminal sequence(1) TGACCGCGCAGCGGCCTTTTGTCAGCGCGCAGGGCCAGGAGAGCTCTCATTTCCTCCCAG
Sequence, submitted(2) AB593080 link 01
 
Sequence, refered NM_001617.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ADD2 (NCBI Gene 119) finder other clones with this gene.
Synonyms ADDB
Protein Name adducin 2 (beta)
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR326525 RBb16F05 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl