Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pGL4-phVEGFA

Promoter collection, Human VEGFA promoter

Catalog number RDB07681
Resource name pGL4-phVEGFA
Alternative name U2749(2127)-8
Clone info. PCR amplified human VEGFA promoter sequence was inserted into a firefly luciferase vector. Cloned fragment: 43769068 to 43770372(NC_000006.12); relatively -1141 to +164, where +1 corresponds to 1 nt of NM_001025366.2.
PCR cloning, forward primer: 5’- GGCGGGTAGGTTTGAATCAT -3’; reverse primer : 5’- AGGGATAAAACCCGGATCAA -3’. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human vascular endothelial growth factor A genomic DNA
Depositor|Developer DNA Bank, | Kishikawa, Shotaro |
 
Other clones in our bank human VEGFA (NCBI Gene 7422) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization.  2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07681 pGL4-phVEGFA DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07681.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content HIF-1 signaling pathway (English text)
Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB07681_A4Am.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer:
Sequence file: RDB07681_A4Ama.seq check
>07681_07681_A4Am_pGL4-4174F_C10_07.ab1
    1 AAGGGGCCAG GAAAATTTTC TCTGGCCTAA CTGGCCGGTA CCTGAGCTCG CTAGCCTCGA
   61 GGATGGCGGG TAGGTTTGAA TCATCACGCA GGCCCTGGCC TCCACCCACC CCCACCAGCC
  121 CCCTGGCCTC AGTTCCCTGG CAACATCTGG GGTTGGGGGG GCAGCAGGAA CAAGGGCCTC
  181 TGTCTGCCCA GCTGCCTCCC CCTTTGGGTT TTGCCAGACT CCACAGTGCA TACGTGGGCT
  241 CCAACAGGTC CTCTTCCCTC CCAGTCACTG ACTAACCCCG GAACCACACA GCTTCCCGTT
  301 CTCAGCTCCA CAAACTTGGT GCCAAATTCT TCTCCCCTGG GAAGCATCCC TGGACACTTC
  361 CCAAAGGACC CCAGTCACTC CAGCCTGTTG GCTGCCGCTC ACTTTGATGT CTGCAGGCCA
  421 AATGAGGGCT CCAGATGGCA CATTGTCAGA GGGACACACT GTGGCCCCTG TGCCCAGCCC
  481 TGGGCTCTCT GTACATGAAG CAACTCCAGT CCCAAATATG TAGCTGTTTG GGAGGTCAGA
  541 AATAGGGGGT CCAGGAGCAA ACTCCCCCCA CCCCCTTTCC AAAGCCCATT CCCTCTTTAG
  601 CCAGAGCCGG GGTGTGCAGA CGGCAGTCAC TAGGGGGCGC TCGGCCACCA CAGGGAAGCT
  661 GGGTGAATGG AGCGAGCAGC GTCTTCGAGA GTGAGGACGT GTGTGTCTGT GTGGGTGAGT
721 GAGTGTGTGC GTGTGGGGTT GAGGGTGTTG GAGCGGGCGT ATGCCCTGTG GTGA
//
Primer:
Sequence file: RDB07681_A4Amb.seq check
>07681_07681_A4Am_pGL4-136R_D10_10.ab1
    1 GGCCTAAAGT TTTTTTGGCA TCTTCCATGG TGGCTTTACC AACAGTACCG GATTGCCAAG
   61 CTTGGCCGCC GAGGCCAGAT CTTGATAGGG ATAAAACCCG GATCAATGAA TATCAAATTC
  121 CAGCACCGAG CGCCCTGGCC GGTGAGTCCG CTGACCGGTC CACCTAACCG CTGCGCCTCC
  181 CGACAGAGCG CTGGTGCTAG CCCCCAGCGC CACGACCTCC GAGCTACCCG GCTGCCCCAA
  241 GCCTCCGCGA TCCTCCCCGC TACCAGCCGA CTTTTAAAAA AAAAAGGGGG GGGCGCATGG
  301 CTCCGCCCCG CCGGGACCCC GCCCCCGGCC CGCCCCGGGG GGCGGGGACA GGCGAGCCTC
  361 AGCCCCTCCA CACGCGGCTC GGGCCCGGGC TCTGCGGACG CCCAGTGAAG CCTGGCCCGC
  421 AGCCCGCCGC AATGAAGGGG AAGCTCGACC CCCACCAAGG TTCACAGCCT GAAAATTACC
  481 CATCCGCCCC CGGAAACTCT GTCCAGAGAC ACGCGCCCGC GGGGCATTGG CGAGGAGGGA
  541 GCAGGAAAGT GAGGTTACGT GCGGACAGGG CCTGAGAGCC GTTCCCTCTT TGCTAGGAAT
  601 ATTGAAGGGG GCAGGGGAAG GCGGAGAGCC GGACAGGGAC GGGTGGGGAG AGGGACACAC
  661 AGATCTATTG GAATCCTGGA GTGACCCCTG GCCTTCTCCC CGCTCCAACA CCCTCAACCC
  721 CACACGCACA CACTCACTCA CCCACACAGA CACACACGTC CTCACTCTCG AAGACGCTGC
  781 TCGCTCCATT CACCCAGCTT CCCTGTGGTG GCCGAGCGCC CCCTAGTGAC TGCCGTCTGC
  841 ACACCCCGGC TCTGGCTAAA GAGGGAATGG GCTTTGGAAA GGGGGTGGGG GGAGTTTGCT
  901 CCTGGACCCC CTATTTCTGA CCTCCCAAAC AGCTACATAT TTGGGACTGG AGTTGCTTCA
  961 TGTACAGAGA GCCCAGGGCT GGGCACAGGG GCCACAGTGT GTCCCTCTGA CAATGTGCCA
 1021 TCTGGAGCCC TCATTTGGCC CTGCAGACAT CAAAGTGAGC GGCAGGCCAA CAAGCTGGAG
 1081 TGACTGGGTC CTTTGGGAAG TGTCCAGGAT GCTTCCCAAG GAGAGAATTG CACCAGGTTG
1141 TTGAGCTGGA GAAACCGGGA AGGT
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

user report Hasan, A.U., Eicosapentaenoic acid upregulates VEGF-A through both GPR120 and PPARγ mediated pathways in 3T3-L1 adipocytes. Mol. Cell. Endocrinol. 406:10-18 (2015). PMID 25697344.

2020.02.12

GNP_filter3_RDBDEP_html_191130.pl