DNA Bank Top |  KEGG KO K05448 > 

RIKEN DNA Bank Human Resource - VEGFA

Gene ID NCBI Gene 7422 |  KEGG hsa:7422
Gene Symbol VEGFA
Protein Name vascular endothelial growth factor A
Synonyms MVCD1|VEGF|VPF
Featured content HIF-1 signaling pathway - human

Link

Ortholog resource in our bank

  VEGFA

External database

human VEGFA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14404 pEF/HRE-Fluc HIF-1 dependent promoter reporter containing HRE.    
RDB07681 pGL4-phVEGFA Promoter collection, Human VEGFA promoter    
RDB07626 pRx-IRES-bsr-hVEGF    
RDB03986 pRxhVEGFbsr Retroviral vector of human VEGF    
RDB03961 pCMVhVEGF Expression vector of human VEGF cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056007 IRAK140A07 pCMV-SPORT6 BC065522 NM_001033756 Partial
HGX007806 IRAK019I14 pCMV-SPORT6 BC011177 NM_003376
HGX016810 IRAK042A10 pCMV-SPORT6 BC019867 NM_003376

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE013307 W01A033E11 pENTR-TOPO IRAK140A07 BC065522 NM_001033756  
HGE013311 W01A033E15 pENTR-TOPO IRAK140A07 BC065522 NM_001033756  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054106 ARe35E10 pKA1U5 NM_003376.4  
TGGGGCGCGGAGGCTTGGGGCAGCCGGGTAGCTCGGAGGTCGTGGCGCTGGGGGCTAGCA
HKR405782 RBdS014H14 pGCAP10 NM_003376.4  
GGCGGAGGCTTGGGGCAGCCGGGTAGCTCGGAGGTCGTGGCGCTGGGGGCTAGCACCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl