Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Promoter collection, Human SERPINE1 promoter

Catalog number RDB07461
Resource name pGL4-phSERPINE1(PAI-1)
Alternative name U2851-5
Clone info. PCR amplified human SERPINE1 promoter sequence was inserted into a firefly luciferase vector. Cloned fragment: 101125677 to 101127125(NC_000007.14); relatively -1412 to +37, where +1 corresponds to 1 nt of NM_000602.4.
PCR cloning, forward primer: GCCACTCCTCATCACTCGCATT; reverse primer: CCCTGCAGCCAAACACAGC. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 genomic DNA
Depositor|Developer DNA Bank, |
Other clones in our bank human SERPINE1 (NCBI Gene 5054) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07461 pGL4-phSERPINE1(PAI-1) DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07461.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Dnaconda's recommendation EXR0096e (English text)
Featured content Dnaconda's recommendation EXR0096j (Japanese text)
Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB13380_A5Dn.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F
Sequence file: RDB13380_A5Dna.seq check
Primer: pGL4-136R
Sequence file: RDB13380_A5Dnb.seq check

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles

user report Resmini, G., HMGA1 regulates the Plasminogen activation system in the secretome of breast cancer cells. Sci. Rep. 7 (1): 11768 (2017). PMID 28924209.
