Resource data sheet
Prev.

pGL4-phSERPINE1(PAI-1)

Promoter collection, Human SERPINE1 promoter

Catalog number RDB07461
Resource name pGL4-phSERPINE1(PAI-1)
Alternative name U2851-5
Clone info. Promoter collection. PCR amplified human SERPINE1 promoter sequence was inserted into a firefly luciferase vector. Genomic DNA (101,125,677 - 101,127,125nt of NC_000007.14) corresponding to 1 to 37nt of NM_000602.4 and 1.4 kb up-stream was cloned.
F-primer: GCCACTCCTCATCACTCGCATT; R-primer: CCCTGCAGCCAAACACAGC. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human SERPINE1 (NCBI Gene 5054) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07461 pGL4-phSERPINE1(PAI-1) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB07461.pdf from Depositor

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13380_A5Dn.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F RDB13380_A5Dna.seq
>07461_13380_A5Dn_pGL4-4174F_A06_03.ab1
    1 CTGGTCAGAC TTTCTCTGGC CTACTGGCCG GTACCTGAGC TCGCTAGCCT CGAGGATGCC
   61 ACTCCTCATC ACTCGCATTA CCACCAGAGC TCCACTCCCT GTCAGATCAG CGGCGGCATT
  121 AGATTCTCAT AGGAGCTCGA ACCCTATTCT AAACTGTTCA TGTGAGGGAT CTAGGTTGCA
  181 AGCTCCCTAT GAGAATCTAA TGCCTGATGA TCTGTCACGG TCTCCCATCA CCCCTAGATG
  241 GGACCATCTA GTTGCAGGAA AACAAGCTCA GGGCTCCCAC TGATTCTACA CGATGGTGAA
  301 TTGTGGAATT ATTTCATTAT ATATATTACA ATGTAATAAT AATAGAAATA AAGCACACAA
  361 TAAATGTAAT GTGCTTGAAT CATCCCGAAA CCATCCCACC CTGGTCTGTG AAAAAATTGT
  421 CTTCCATGAA ACCAGTCCCT GGTGCCAAAA ACGTTGAGGA CCACTGCTCC ACAGAATCTA
  481 TCGGTCACTC TTCCTCCCCT CACCCCCTTG CCCTAAAAGC ACACCCTGCA AACCTGCCAT
  541 GAATTGACAC TCTGTTTCTA TCCCTTTTCC CCTTGTGTCT GTGTCTGGAG GAAGAGGATA
  601 AAGGACAAGC TGCCCCAAGT CCTAGCGGGC AGCTCGAGGA AGTGAAACTT ACACGTTGGT
  661 CTCCTGTTTC CTTACCAAGC TTTTACCATG GTAACCCCTG GTCCCGTTCA GCCACCACCA
  721 CCCCACCCAG CACACCTCCA ACCTCAGCCA GACAAGGTTG TTGACACAAG AGAGCCCTCA
  781 GGGGCACAGA GAGAGTCTGG ACACGTGGGG GAGTCAGCCG TGTATCATCG GAGGCGGCCG
  841 GGCACATGGC AGGGATGAGG GAAAGACCAA GAGTCCTCTG TTGGGCCCAA GTCCTAGACA
  901 GACAAAACCT AGACAATCAC GTGGCTGGCT GCATGCCCTG TGGCTGTTGG GCTGGGCCCA
  961 GGAGGAGGGA GGGGCGCTCT TTCCTGGAGG TGGTCCAGAG CACCGGGTGG ACAGGCCCTT
 1021 GGGGAAAACC TTCACGTTTT GAATGGAAGA TAATCCTTGG ATACTCGACA GTGACCTGGC
1081 TTCGCTAACG AAAAGGCAGG CTAACGGTTG A
//
Primer: pGL4-136R RDB13380_A5Dnb.seq
>07461_13380_A5Dn_pGL4-136R_B06_06.ab1
    1 GCTATGCTAT GGCATCTTCA TGGTGGCTTT ACCAACAGTA CCGGATTGCC AAGCTTGGCC
   61 GCCGAGGCCA GATCTTGATC CCTGCAGCCA AACACAGCTG TGCTCCTCTG TGGGCCACTG
  121 CCTCCTTTTA TACCAGATGT GGGCAGGAAA TAGATGAACT CATGTTCCAG CCCCACCCAC
  181 TCACTGGCTC TGGGAGTCCG TCTGAACAGC CAGCGGGTCC CCCTCGACAC CTCCCTCTCT
  241 GGGACTTGCT GAGGCATGTG TGTGTGTGTG TGTGTGCTGC TCTGTGTGTG TACGTGTGTA
  301 AGAGCATTCA GGAACAATTG AGCAAACCCC AATAGCCTTG GCCTGAGAAC CTCCCTTGAC
  361 CTTTCTGCCC TCTGCCTGTG TCTGTCTCTC CCGGATGTCC TGCCAGGTTG ACTGTCTGCC
  421 ATGCCGGGTG ACCCAAAAAG CCTAGGACCC CTAGTGTTCA GCTTGGAGAA AAAAAAAACA
  481 GCTCACGTTG CCTGCTTTTC CTTTGGCGAA CCAGGTCACT GTGGAGTTAT CAAAGATAAC
  541 CTCCATCAAA ACGTGGAAGT TTTCCCCCAG GGCTGTCCAC CCGGTGCTCT GGACCACCTC
  601 CAGGAAAGAG CGCCCCTCCC TCCTCCTGGG CCCAGCCCAA CAGCCACAGG GCATGCAGCC
  661 AGCCACGTGA TTGTCTAGGT TTTGTCTGTC TAGGACTTGG GCCCAACAGA GGACTCTTGG
  721 TCTTTCCCTC ATCCCTGCCA TGTGCCCGGC CGCCTCCGAT GATACACGGC TGACTCCCCC
  781 ACGTGTCCAG ACTCTCTCTG TGCCCCTGAG GGCTCTCTTG TGTCAACAAC CTTGTCTGGC
  841 TGAGGTTGGA GGTGTGCTGG TGGGGTTTGT GTGGGGGGGG TCTTGAAACG GGAAACCCAA
  901 GGGGGTATAC CCATGGTAAA AAGCCTTTGG GTTAAGGGAA AACAGGGAGA CCCAAACGTG
  961 TAAAGTTTTC ACTTTCCCTC GAGCTGCCCC GCTAGGACTT TGGGGGCAGC TTTGTTCCCT
 1021 TTTATCCCTC TTTCCCTCCA GACACAGACA CAAAGGGGAA AAAGGCATAG AAACAGAGTG
 1081 GTCCAATTCC ATGGCCAAGT TTGCCATGGT GTGCTTTTAC GGCCAGCGTG AAGGGAGAGA
1141 GGACCGATAG GTAATTCG
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Resmini, G., HMGA1 regulates the Plasminogen activation system in the secretome of breast cancer cells. Sci. Rep. 7 (1): 11768 (2017). PMID 28924209.

2018.12.10

GNP_filter3_RDBDEP_html_181012.pl