Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SERPINE1

Gene ID (NCBI) 5054
Gene Symbol SERPINE1
Protein Name serpin family E member 1
Synonyms PAI|PAI-1|PAI1|PLANH1
Databases KEGG hsa:5054 |  NCBI Gene 5054
Featured content Hippo signaling (human)
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03982)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05506 pKM2L-phPAI1 Promoter Bank clone, Human plasminogen activator inhibitor 1 (PAI-1) promoter
RDB05848 pAxit-phPAI1-rLuc (R) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB05849 pAxit-phPAI1-rLuc (F) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB07461 pGL4-phSERPINE1(PAI-1) Promoter collection, Human SERPINE1 promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005759 IRAK014G15 pCMV-SPORT6 BC010860 NM_000602 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042129 ARe05F09 pKA1U5 NM_000602.2  
GGCACAGCTGNTGTTTGGCTGCAGGGCCAAGAGCGCTGTTCAAGAAGACCCACACGCCCC
HKR047706 ARe19E10 pKA1U5 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR048147 ARe20G03 pKA1U5 NM_000602.2  
GACACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCC
HKR048552 ARe21G08 pKA1U5 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR052529 ARe31F09 pKA1U5 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR056479 ARe41D07 pKA1U5 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR058153 ARe45G09 pKA1U5 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTTCAAGAAGACCCACACGCCCCCCT
HKR060052 ARe50C04 pKA1U5 NM_000602.2  
GACAGCTGTGNTTTGGCTGCAGGGCCAAGAGCGCTGNTCAAGAAGACCCACACGCCCCCC
HKR061649 ARe54C01 pKA1U5 NM_000602.2  
TGACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTTCAAGAAGACCCACACGCCCCCC
HKR066103 ARe65E07 pKA1U5 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR162901 ARi07E05 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR164170 ARi10H02 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGTAGCGCTGTCAAGAAGACCCACACGCCCCCCT
HKR166806 ARi17A06 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR173632 ARi34B08 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR176079 ARi40D07 pGCAP10 NM_000602.2  
GAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTCCA
HKR178132 ARi45F12 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR182555 ARi56G11 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR183323 ARi58F03 pGCAP10 NM_000602.2  
GAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTCCA
HKR205278 ARiS013D06 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR218046 ARiS045B22 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR222014 ARiS055A14 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR234310 ARiS085M22 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR235168 ARiS087P08 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR235411 ARiS088I19 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR243827 ARiS109J11 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR243887 ARiS109L23 pGCAP10 NM_000602.2  
TGACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCT
HKR277624 ARiS194A24 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC
HKR277685 ARiS194D13 pGCAP10 NM_000602.2  
GACAGCTGTGTTTGGCTGCAGGGCCAAGAGCGCTGTCAAGAAGACCCACACGCCCCCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl