Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsSMAD3

Expression vector of human SMAD3.

Catalog number RDB07019
Resource name pCMFlag_hsSMAD3
Alternative name SET-0137_3-8-1
Clone info. Expression vector of human SMAD3. Expression has not yet been confirmed.
PCR cloning, forward primer: atgtcgtccatcctgcctttcactc; reverse primer: ctaagacacactggaacagcggatg. Nucleotide substitution A607G(silent) to NM_005902.3.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human SMAD3 cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human SMAD3 (NCBI Gene 4088) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07019 pCMFlag_hsSMAD3 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07019.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB07019_A7B6p1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward
Sequence file: RDB07019_A7B6a.seq check
>07019_07019_A7B6_CMV-Forward_F04_16_ABI24.ab1
    1 CGTCCTCCGC CCATTGACGC AATGGGCGGT AGGCGTGTAC GGTGGGAGGT CTATATAAGC
   61 AGAGCTCTCT GGCTAACTAG AGAACCCACT GCTTACTGGC TTATCGAAAT TAATACGACT
  121 CACTATAGGG AGACCCAAGC TGAATTCACC ATGGACTACA AGGACGATGA CGATAAGGCG
  181 GCCATGTCGT CCATCCTGCC TTTCACTCCC CCGATCGTGA AGCGCCTGCT GGGCTGGAAG
  241 AAGGGCGAGC AGAACGGGCA GGAGGAGAAA TGGTGCGAGA AGGCGGTCAA GAGCCTGGTC
  301 AAGAAACTCA AGAAGACGGG GCAGCTGGAC GAGCTGGAGA AGGCCATCAC CACGCAGAAC
  361 GTCAACACCA AGTGCATCAC CATCCCCAGG TCCCTGGATG GCCGGTTGCA GGTGTCCCAT
  421 CGGAAGGGGC TCCCTCATGT CATCTACTGC CGCCTGTGGC GATGGCCAGA CCTGCACAGC
  481 CACCACGAGC TGCGGGCCAT GGAGCTGTGT GAGTTCGCCT TCAATATGAA GAAGGACGAG
  541 GTCTGCGTGA ATCCCTACCA CTACCAGAGA GTAGAGACAC CAGTTCTACC TCCTGTGTTG
  601 GTGCCACGCC ACACAGAGAT CCCGGCCGAG TTCCCCCCAC TGGACGACTA CAGCCATTCC
  661 ATCCCCGAAA ACACTAACTT CCCCGCAGGC ATCGAGCCCC AGAGCAATAT TCCAGAGACC
  721 CCACCCCCTG GCTACCTGAG TGAAGATGGA GAAACCAGTG ACCACCAGAT GAACCACAGC
  781 ATGGACGCAG GTTCTCCAAA CCTATCCCCG AATCCGATGT CCCCAGCACA TAATAACTTG
  841 GACCTGCAGC CAGTTACCTA CTGCGAGCCG GCCTTCTGGT GCTCCATCTC CTACTACGAG
  901 CTGAACCAGC GCGTCGGGGA GACATTCCAC GCCTCGCAGC CATCCATGAC TGTGGATGGC
  961 TTCACCGACC CCTCCCAATT CGGAGCGCTT TCTGCCCTAG GGCTGCTCTC CCAAATGTCA
 1021 ACAGGAAATG CAGCAGTGGG AGCTGGACAC GGAGGACACA TCGCGAGCCG TGCCGACTCT
1081 ACCTACAATC GGAAGGGGAA GGG
//
Primer: BGH_rev2
Sequence file: RDB07019_A7B6b.seq check
>07019_07019_A7B6_BGH_rev2_E10_13_ABI24.ab1
    1 CGGTTCGGGA TAGAGGCACG GGGGAGGGGC AACAACAGAT GGCTGGCAAC TAGAAGGCAC
   61 AGTCGAGGCT GATCAGCGAG CTCTAGCATT TAGGTGACAC TATAGAATAG GGCCCTCTAG
  121 ATGCATGCTC GAGCGGCCCT AAGACACACT GGAACAGCGG ATGCTTGGGG AGCCCATCTG
  181 GGTGAGGACC TTGTCAAGCC ACTGCAAAGG CCCATTCAGG TGCAGCTCAA TCCAGCAGGG
  241 GGTACTGGTC ACAGTCTGTC TCCTGTACTC CGCTCCCCAG CCTTTGACGA AGCTCATGCG
  301 GATGGTGCAC ATTCGGGTCA ACTGGTAGAC AGCCTCAAAG CCCTGGTTGA CCGACTGGGC
  361 CAGGAGGGCA GCGAACTCCT GGTTGTTGAA GATCTTCAGG TTGCATCCTG GTGGGATCTT
  421 GCAGACGGTG GCCGGGTGCC AGCCATAGCG CTGGTTACAG TTGGGAGACT GGACAAAAAT
  481 AGCGCTGTCA CTGAGGCACT CTGCGAAGAC CTCCCCTCCG ATGTAGTAGA GCCGCACGCC
  541 TCTTCCGATG TGTCTCCGTG TCAGCTCCAC TGCTGCATTC CTGTTGACAT TGGAGAGCAG
  601 CCCTAGGCAG AAGCGCTCCG AATTGGAGGG GTCGGTGAAG CCATCCACAG TCATGGATGG
  661 CTGCGAGGCG TGGAATGTCT CCCCGACGCG CTGGTTCAGC TCGTAGTAGG AGATGGAGCA
  721 CCAGAAGGCC GGCTCGCAGT AGGTAACTGG CTGCAGGTCC AAGTTATTAT GTGCTGGGGA
  781 CATCGGATTC GGGGATAGGT TTGGAGAACC TGCGTCCATG CTGTGGTTCA TCTGGTGGTC
  841 ACTGGTTTCT CCATCTTCAC TCAGGTAGCC AGGGGGTGGG GTCTCTGGAA TATTGCTCTG
  901 GGGCTCGATG CCTGCGGGGA AAGTTAGTGT TTTCGGGGAT GGAATGGCTG TAGTCGTCCA
  961 GTGGGGGGAA ACTCGGGCCG GGATCTCTGT GTGGCGTGGC ACCAACACAG GAGGTAGAAC
 1021 TGGTTGTCTC TACTCTCTGG GTAGTGGTAG GATTTCACGG CAGACCTCGT CCTTCCTTCC
1081 ATATGAGCCG AGCTCACCAC AGCTCCATGG GCCCCCGCCA AG
//
Primer: SV40pro_F_V2
Sequence file: RDB07019_A7B6c.seq check
>07019_07019_A7B6_SV40pro_F_V2_F10_16_ABI24.ab1
    1 GGGCGAGCTT TTTGGGAGGC TAGGCTTTTG CAAAGCTCCC GGGCAGCTTG GATATCCATT
   61 TTCGGATCTG ATCAAGAGAC AGGATGAGGA TCGTTTCGCA TGATTGAACA AGATGGATTG
  121 CACGCAGGTT CTCCGGCCGC TTGGGTGGAG AGGCTATTCG GCTATGACTG GGCACAACAG
  181 ACAATCGGCT GCTCTGATGC CGCCGTGTTC CGGCTGTCAG CGCAGGGGCG CCCGGTTCTT
  241 TTTGTCAAGA CCGACCTGTC CGGTGCCCTG AATGAACTGC AGGACGAGGC AGCGCGGCTA
  301 TCGTGGCTGG CCACGACGGG CGTTCCTTGC GCAGCTGTGC TCGACGTTGT CACTGAAGCG
  361 GGAAGGGACT GGCTGCTATT GGGCGAAGTG CCGGGGCAGG ATCTCCTGTC ATCTCACCTT
  421 GCTCCTGCCG AGAAAGTATC CATCATGGCT GATGCAATGC GGCGGCTGCA TACGCTTGAT
  481 CCGGCTACCT GCCCATTCGA CCACCAAGCG AAACATCGCA TCGAGCGAGC ACGTACTCGG
  541 ATGGAAGCCG GTCTTGTCGA TCAGGATGAT CTGGACGAAG AGCATCAGGG GCTCGCGCCA
  601 GCCGAACTGT TCGCCAGGCT CAAGGCGCGC ATGCCCGACG GCGAGGATCT CGTCGTGACC
  661 CATGGCGATG CCTGCTTGCC GAATATCATG GTGGAAAATG GCCGCTTTTC TGGATTCATC
  721 GACTGTGGCC GGCTGGGTGT GGCGGACCGC TATCAGGACA TAGCGTTGGC TACCCGTGAT
  781 ATTGCTGAAG AGCTTGGCGG CGAATGGGCT GACCGCTTCC TCGTGCTTTA CGGTATCGCC
  841 GCTCCCGATT CGCAGCGCAT CGCCTTCTAT CGCCTTCTTG ACGAGTTCTT CTGAGCGGGA
  901 CTCTGGGGGT TCGAAATGAC CGACCAAGCG ACGCCCAACC CTGCCATCAC GAGATTTCGA
  961 TTCCCACCGC CCGCCTTCTA TGAAAGGTTG GGCTTTCGGA ATCGTTTTCC CGGGACGCCC
 1021 GGCTGGATGA TCCTCCAGCG CGGGGATCTC ATGCTGGGAG CTCTTCGGCC CACCCCCAAC
1081 TTGATTATTG GCAGCTATAT TGCTTACGAA TAAAGCCAAA TAGGCAATTC CCACCGA
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

user report Yuki, R., Desuppression of TGF-beta signaling via nuclear c-Abl-mediated phosphorylation of TIF1 gamma/TRIM33 at Tyr-524, -610, and -1048. Oncogene 38 (5): 637-655 (2019). PMID 30177833.
user report Hirata, K., Forkhead box protein A1 confers resistance to transforming growth factor-beta-induced apoptosis in breast cancer cells through inhibition of Smad3 nuclear translocation. J Cell Biochem. 2018 Sep 11. doi: 10.1002/jcb.27551. [Epub ahead of print] PMID 30206966.

2020.02.22

GNP_filter3_RDBDEP_html_191130.pl