DNA Bank Top |  KEGG KO K23605 > 

RIKEN DNA Bank Human Resource - SMAD3

Gene ID NCBI Gene 4088 |  KEGG hsa:4088
Gene Symbol SMAD3
Protein Name SMAD family member 3
Synonyms HSPC193|HsT17436|JV15-2|LDS1C|LDS3|MADH3|hMAD-3|hSMAD3|mad3
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Endocytosis (human)

Link

Ortholog resource in our bank

  SMAD3

External database

human SMAD3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07019 pCMFlag_hsSMAD3 Expression vector of human SMAD3.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044215 IRAK110I23 pCMV-SPORT6 BC050743 NM_005902 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076148 ARe90G04 pKA1U5 NM_005902.3  
GACCCCACACGCTGGGTTCCCACAGGATGCGACATTCCCACAGGATGGGACAACTGCATG
HKR180529 ARi51F09 pGCAP10 NM_005902.3  
GGGTGCTGGGGTTAGGTCACTGCTGGGCTGAAGCGCACTGACCATAAGAGCAACATGTGG
HKR247255 ARiS118C07 pGCAP10 NM_005902.3  
GGCCACTTGGAGTCTCGCGNCCGCCGCCTCCGCCCCGCGTTCGGGGCCTTCCCGACCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl