Resource data sheet
Prev.

pCMFlag_hsOct3/4 isoform1

Expression vector of human Oct3/4 isofom 1

Catalog number RDB06598
Resource name pCMFlag_hsOct3/4 isoform1
Alternative name SET-0212_14-1
Clone info. Expression vector of human Oct3/4 isofom 1. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: gcgggacacctggcttcggatt; R-primer: cctcagtttgaatgcatgggaga. Nucleotide substitution C81T (Phe9Phe), C843T (Ile263Ile), C1101T (Ser349Ser) to NM_002701. iPS Yamanaka factor.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human Oct3/4 cDNA
Depositor DNA Bank, |
 
Other clones in our bank human POU5F1 (NCBI Gene 5460) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06598 pCMFlag_hsOct3/4 isoform1 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB06598.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12306_A7Bmp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB12306_A7Bma.seq
>06598_12306_A7Bm_CMV-Forward_G12_07_ABI08.ab1
    1 TTGATACAAC TTCCCGCCCC ATTTGACGCA ATGGGCGGTA GGCGTGTTAC GGTGGGAGGT
   61 CTATATAAGC AGAGCTCTCT GGCTAACTAG AGAACCCACT GCTTACTGGC TTATCGAAAT
  121 TAATACGACT CACTATAGGG AGACCCAAGC TGAATTCACC ATGGACTACA AGGACGATGA
  181 CGATAAGGCG GCCGCGGGAC ACCTGGCTTC GGATTTTGCC TTCTCGCCCC CTCCAGGTGG
  241 TGGAGGTGAT GGGCCAGGGG GGCCGGAGCC GGGCTGGGTT GATCCTCGGA CCTGGCTAAG
  301 CTTCCAAGGC CCTCCTGGAG GGCCAGGAAT CGGGCCGGGG GTTGGGCCAG GCTCTGAGGT
  361 GTGGGGGATT CCCCCATGCC CCCCGCCGTA TGAGTTCTGT GGGGGGATGG CGTACTGTGG
  421 GCCCCAGGTT GGAGTGGGGC TAGTGCCCCA AGGCGGCTTG GAGACCTCTC AGCCTGAGGG
  481 CGAAGCAGGA GTCGGGGTGG AGAGCAACTC CGATGGGGCC TCCCCGGAGC CTGTGCACCG
541 TCACCCCTGG TGCCGTGAAG CTGG
//
Primer: BGH_rev2 RDB12306_A7Bmb.seq
>06598_12306_A7Bm_BGH_rev2_H12_08_ABI08.ab1
    1 GCTATGTTGG GGGGCAGGGA GGCACGGGGG AGGGGCAAAC AACAGATGGC TGGCAACTAG
   61 AAGGCACAGT CGAGGCTGAT CAGCGAGCTC TAGCATTTAG GTGACACTAT AGAATAGGGC
  121 CCTCTAGATG CATGCTCGAG CGGCCCCTCA GTTTGAATGC ATGGGAGAGC CCAGAGTGGT
  181 GACAGAGACA GGGGGAAAGG CTTCCCCCTC AGGGAAAGGG ACCGAGGAGT ACAGTGCAGT
  241 GAAGTGAGGG CTCCCATAGC CTGGGGTACC AAAATGGGGC CCTGGGGCCA GAGGAAAGGA
  301 CACTGGTCCC CCTGAGAAAG GAGACCCAGC AGCCTCAAAA TCCTCTCGTT GTGCATAGTC
  361 GCTGCTTGAT CGCTTGCCCT TCTGGCGCCG GTTACAGAAC CACACTCGGA CCACATCCTT
  421 CTCGAGCCCA AGCTGCTGGG CAATGTGGCT GATCTGCTGC AGTGTGGGTT TCGGGCACTG
  481 CAGGAACAAA TTCTCCAGGT TGCCTCTCAC TCGGTTCTCG ATACTGGTTC GCTTTCTCTT
  541 TCGGGCCTGC ACGAGGGTTT CTGCTTTGCA TATCTCCTGA AGATTTTCAT TGTTGTCAGC
  601 TTCCTCCACC CACTTCTGCA GCAAGGGCCG CAGCTTACAC ATGTTCTTGA AGCTAAGCTG
  661 CAGAGCCTCA AAGCGGCAGA TGGTCGTTTG GCTGAATACC TTCCCAAATA GAACCCCCAG
  721 GGTGAGCCCC ACATCGGCCT GTGTATATCC CAGGGTGATC CTCTTCTGCT TCAGGAGCTT
  781 GGCAAATTGC TCGAGTTCTT TCTGCAGAGC TTTGATGTCC TGGGACTCCT CCGGGTTTTG
  841 CTCCAGCTTC TCCTTCTCCA GCTTCACGGC ACCAGGGGTG ACGGTGCAGG GCTCCCGGGG
  901 AGGCCCCATC GGAGTTGCTC TCCACCCCGA CTCCTGCTTC GCCCTCAGCT GAGAGGTCTC
  961 CAAGCCGCCT TGGGGCACTA GCCCCACTCC AACCTGGGGC CACAGTACGC CATCCCCCCA
 1021 CAGAACTCAT ACGGCGGGGG GCATGGGGGA ATCCCCCACA CCTCAGAGCC TGCCCAACCC
 1081 CCGGCCGATC CTGGTCTCAG AAGGCCCTGG AAGCTAAGCA GTTCGAGGAT CACCCAGTCC
 1141 GGCTCGACCC CTGGCCAATC ACTTCACCAC TGAAGGGCGG AAGCAAAATC CGAAGCCCAG
1201 TG
//
Primer: SV40pro_F_V2 RDB12306_A7Bmc.seq
>06598_12306_A7Bm_SV40pro_F_V2_F11_17_ABI24.ab1
    1 GGAACGAGCT TTTTTTTGGG AGGGCTAGGC TTTTTGCAAA AGCTCCCCCC GAGCTAGGGA
   61 TATCCATTTT CGGATCTGAA AAAAAAAAAC AGGATGAGGA TCGTTTCGCA TGATTGAACA
  121 AGATGGATTG CACGCAGGTT CTCCGGCCGC TTGGGTGGAG AGGCTATTCG GCTATGACTG
  181 GGCACAACAG ACAATCGGCT GCTCTGATGC CGCCGTGTTC CGGCTGTCAG CGCAGGGGCG
  241 CCCGGTTCTT TTTGTCAAGA CCGACCTGTC CGGTGCCCTG AATGAACTGC AGGACGAGGC
  301 AGCGCGGCTA TCGTGGCTGG CCACGACGGG CGTTCCTTGC GCAGCTGTGC TCGACGTTGT
  361 CACTGAAGCG GGAAGGGACT GGCTGCTATT GGGCGAAGTG CCGGGGCAGG ATCTCCTGTC
  421 ATCTCACCTT GCTCCTGCCG AGAAAGTATC CATCATGGCT GATGCAATGC GGCGGCTGCA
  481 TACGCTTGAT CCGGCTACCT GCCCATTCGA CCACCAAGCG AAACATCGCA TCGAGCGAGC
  541 ACGTACTCGG ATGGAAGCCG GTCTTGTCGA TCAGGATGAT CTGGACGAAG AGCATCAGGG
  601 GCTCGCGCCA GCCGAACTGT TCGCCAGGCT CAAGGCGCGC ATGCCCGACG GCGAGGGATC
  661 TCGTCGTGAC CCATGGCGAT GCCTGCTTGC CGAATATCAT GGTGGAAAAA TGGGCCGCTT
  721 TTCTGGATTC ATCGACTGTG GCCGGCTGGG TGTGGGCGGG ACCGCTATCA GGACATAGCG
  781 TTGGCTACCC GTGATATTGC TGAAGAGCTT TGGCGGCGAA TGGGCTGACC GCTTCCTCGT
  841 GCTTTACGGT ATCGCCGCTC CCGATTCGCA GCGCATCGCC TTCTATCGCC TTCTTGACGA
  901 GTTCTTCTGA ACGGGACTCT GGGGTTCCAA AATGACCGAC CAAGCGACGC CCAACCTGCC
  961 ATCACGAGAT TTTCGATTCC ACCGCCCGCC TTTCTATGGA AAGGTTGGGC TTCCGGAATC
 1021 CGTTTTTCCC GGGACCGCCG GCCTGGATGG ATCCTTCCAG CCGCCGGGGA ATCCTCAATG
 1081 CTGAAGGTTC CCGTCGCGCC CACCCCAACC TGGGTTTATT TGCCAGGCTT AATATGGTTA
 1141 ACCAGATCAA GGCCAATTAG GCCCACCCAC ATTCACACGA ATAAGGGCCC ATGTTTGTTG
1201 TTCCCACACC ATGTGCGCCA CG
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Lin, Y.C., Bovine induced pluripotent stem cells are more resistant to apoptosis than testicular cells in response to mono-(2-ethylhexyl) phthalate. Int. J. Mol. Sci., 15 (3): 5011-5031 (2014). PMID 24658443.

2018.10.22

GNP_filter3_RDBDEP_html_181012.pl